Transcript: Human XR_243907.4

PREDICTED: Homo sapiens D-box binding PAR bZIP transcription factor (DBP), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DBP (1628)
Length:
1696
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_243907.4
NBCI Gene record:
DBP (1628)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_243907.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013755 CGAAGACATCGCTTCTCAGAA pLKO.1 1581 3UTR 100% 4.950 6.930 N DBP n/a
2 TRCN0000235682 ATCTTGCCCTATCAAGCATTC pLKO_005 1537 3UTR 100% 6.000 4.200 N DBP n/a
3 TRCN0000013757 CAGCTGATCTTGCCCTATCAA pLKO.1 1531 3UTR 100% 5.625 3.938 N DBP n/a
4 TRCN0000235684 ACCTTTGACCCTCGAAGACAT pLKO_005 1569 3UTR 100% 4.950 3.465 N DBP n/a
5 TRCN0000244302 CAATCATGAAGAAGGCAAGAA pLKO_005 1621 3UTR 100% 4.950 3.465 N DBP n/a
6 TRCN0000013754 GTGGAGGTGTTGATGACCTTT pLKO.1 1500 3UTR 100% 4.950 3.465 N DBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_243907.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06084 pDONR223 99.3% 42% None 1_24del;575_1455del;1696_1697ins184 n/a
2 ccsbBroad304_06084 pLX_304 0% 42% V5 1_24del;575_1455del;1696_1697ins184 n/a
Download CSV