Transcript: Human XR_244120.1

PREDICTED: Homo sapiens uridine-cytidine kinase 1 like 1 (UCKL1), transcript variant X25, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UCKL1 (54963)
Length:
1918
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_244120.1
NBCI Gene record:
UCKL1 (54963)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_244120.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037576 GCAGTACAACAAGTTTGTCAA pLKO.1 837 3UTR 100% 4.950 6.930 N UCKL1 n/a
2 TRCN0000199954 GACCGCTACTTTGGGACAGAC pLKO.1 1703 3UTR 100% 1.350 1.890 N UCKL1 n/a
3 TRCN0000199988 GCCTATGCATTTCCGCGAGTG pLKO.1 1607 3UTR 100% 0.750 1.050 N UCKL1 n/a
4 TRCN0000381414 ACTTTGGCGACCGCTACTTTG pLKO_005 1695 3UTR 100% 10.800 7.560 N UCKL1 n/a
5 TRCN0000322261 TCCTGGACATGAAGATCTTTG pLKO_005 731 3UTR 100% 10.800 7.560 N Uckl1 n/a
6 TRCN0000037577 CGCACACAACAACTTCAACTT pLKO.1 516 3UTR 100% 4.950 3.465 N UCKL1 n/a
7 TRCN0000037575 CCTCATCATTTCCACCCTCAA pLKO.1 564 3UTR 100% 4.050 2.835 N UCKL1 n/a
8 TRCN0000037574 CGAGTTCATCTTCTACTCCAA pLKO.1 1168 3UTR 100% 2.640 1.848 N UCKL1 n/a
9 TRCN0000197108 GCCCATTTATGACTTCACCAC pLKO.1 615 3UTR 100% 2.160 1.512 N UCKL1 n/a
10 TRCN0000199191 CCCAAGGACATCAGCGATGAC pLKO.1 1445 3UTR 100% 1.350 0.945 N UCKL1 n/a
11 TRCN0000037578 GCGGTGGACAAGCGGGTCAAT pLKO.1 1643 3UTR 100% 0.000 0.000 N UCKL1 n/a
12 TRCN0000024877 CAGTACAACAAGTTTGTCAAA pLKO.1 838 3UTR 100% 4.950 3.465 N Uckl1 n/a
13 TRCN0000322195 CAGTACAACAAGTTTGTCAAA pLKO_005 838 3UTR 100% 4.950 3.465 N Uckl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_244120.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489164 TCTGGCGGTCCCACGAATTCTCCA pLX_317 18.4% 84.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV