Transcript: Human XR_244939.5

PREDICTED: Homo sapiens VPS54 subunit of GARP complex (VPS54), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VPS54 (51542)
Length:
4816
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_244939.5
NBCI Gene record:
VPS54 (51542)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_244939.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380354 CATGATCGAGCTGTCAAATTT pLKO_005 2332 3UTR 100% 15.000 21.000 N Vps54 n/a
2 TRCN0000118365 GCCATGATCGAGCTGTCAAAT pLKO.1 2330 3UTR 100% 13.200 18.480 N VPS54 n/a
3 TRCN0000310642 GCCATGATCGAGCTGTCAAAT pLKO_005 2330 3UTR 100% 13.200 18.480 N VPS54 n/a
4 TRCN0000379896 AGCTAAGCTTGTAGCGATAAT pLKO_005 3176 3UTR 100% 13.200 10.560 N Vps54 n/a
5 TRCN0000304088 GCGATAATGGATAGCTTATTT pLKO_005 3189 3UTR 100% 15.000 10.500 N VPS54 n/a
6 TRCN0000382314 TACTCGTCTGTCAGATTTATT pLKO_005 2811 3UTR 100% 15.000 10.500 N VPS54 n/a
7 TRCN0000304090 TATGGTGTCCCACCTTATTTA pLKO_005 3915 3UTR 100% 15.000 10.500 N VPS54 n/a
8 TRCN0000381129 ACTGCAAGTTGTTGGACTAAA pLKO_005 2981 3UTR 100% 13.200 9.240 N VPS54 n/a
9 TRCN0000381853 CACTTCAGAGCCAAGCTATTA pLKO_005 2489 3UTR 100% 13.200 9.240 N VPS54 n/a
10 TRCN0000118364 CCCATCTGTTACTACTGACAT pLKO.1 2787 3UTR 100% 4.950 3.465 N VPS54 n/a
11 TRCN0000300530 CCCATCTGTTACTACTGACAT pLKO_005 2787 3UTR 100% 4.950 3.465 N VPS54 n/a
12 TRCN0000118362 GCAGGCTTTGTGTGTTGCATA pLKO.1 4107 3UTR 100% 4.950 3.465 N VPS54 n/a
13 TRCN0000118363 GCCTTAAAGATTTGGACCTAA pLKO.1 3484 3UTR 100% 4.950 3.465 N VPS54 n/a
14 TRCN0000118366 GTGGATAACATCCCATCTGTT pLKO.1 2776 3UTR 100% 4.950 3.465 N VPS54 n/a
15 TRCN0000304089 TAGAAGAGGAAAGACTAATAT pLKO_005 1631 3UTR 100% 15.000 9.000 N VPS54 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_244939.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03331 pDONR223 100% 60.1% None (many diffs) n/a
2 ccsbBroad304_03331 pLX_304 0% 60.1% V5 (many diffs) n/a
3 TRCN0000470913 AGCCGTCATCGCTGTTATTTGCGT pLX_317 15.1% 60.1% V5 (many diffs) n/a
Download CSV