Transcript: Human XR_245504.2

PREDICTED: Homo sapiens syntaxin binding protein 5 (STXBP5), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STXBP5 (134957)
Length:
2850
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_245504.2
NBCI Gene record:
STXBP5 (134957)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_245504.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422190 GGGCACTGAACGAGGTAATAT pLKO_005 826 3UTR 100% 15.000 21.000 N STXBP5 n/a
2 TRCN0000429624 GATGCTTGAAGTTCGATTATT pLKO_005 1972 3UTR 100% 15.000 12.000 N STXBP5 n/a
3 TRCN0000431626 TGCAATAACTCTACAAGTATT pLKO_005 1747 3UTR 100% 13.200 9.240 N STXBP5 n/a
4 TRCN0000146824 CCAGGTTATCAAACAGAACTA pLKO.1 2180 3UTR 100% 4.950 3.465 N STXBP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_245504.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09557 pDONR223 100% 64.8% None 1_349del;2495_2557del;2850_2851ins907 n/a
2 ccsbBroad304_09557 pLX_304 0% 64.8% V5 1_349del;2495_2557del;2850_2851ins907 n/a
3 ccsbBroadEn_16093 pDONR223 0% 64.8% None (many diffs) n/a
4 ccsbBroad304_16093 pLX_304 0% 64.8% V5 (many diffs) n/a
Download CSV