Transcript: Human XR_245721.2

PREDICTED: Homo sapiens calmin (CLMN), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLMN (79789)
Length:
13049
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_245721.2
NBCI Gene record:
CLMN (79789)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_245721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149598 CCACGTAGAAAGTTCACTATT pLKO.1 2728 3UTR 100% 13.200 18.480 N CLMN n/a
2 TRCN0000275437 CCACGTAGAAAGTTCACTATT pLKO_005 2728 3UTR 100% 13.200 18.480 N CLMN n/a
3 TRCN0000178734 CGAGTTCATGCACCAGATTAT pLKO.1 1243 3UTR 100% 13.200 18.480 N CLMN n/a
4 TRCN0000149298 GTTAACCTGATGACTGTAGAA pLKO.1 1736 3UTR 100% 4.950 6.930 N CLMN n/a
5 TRCN0000275438 GTTAACCTGATGACTGTAGAA pLKO_005 1736 3UTR 100% 4.950 6.930 N CLMN n/a
6 TRCN0000091740 CGGTTGAACAACATAGCGAAA pLKO.1 389 3UTR 100% 4.050 5.670 N Clmn n/a
7 TRCN0000275388 GACAGAAGAAACCGAATATTA pLKO_005 3231 3UTR 100% 15.000 10.500 N CLMN n/a
8 TRCN0000149719 GACCTTTACACGATGGATAAA pLKO.1 220 3UTR 100% 13.200 9.240 N CLMN n/a
9 TRCN0000275390 GACCTTTACACGATGGATAAA pLKO_005 220 3UTR 100% 13.200 9.240 N CLMN n/a
10 TRCN0000275387 GAGCATTGTTAGTGATCATTA pLKO_005 3710 3UTR 100% 13.200 9.240 N CLMN n/a
11 TRCN0000148983 GTCGATATACAAGATGGCAAA pLKO.1 290 3UTR 100% 4.050 2.835 N CLMN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_245721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08960 pDONR223 100% 23% None (many diffs) n/a
2 ccsbBroad304_08960 pLX_304 0% 23% V5 (many diffs) n/a
3 TRCN0000476552 CCCGCATTGAGATCTTATCGGTTC pLX_317 9.2% 23% V5 (many diffs) n/a
Download CSV