Transcript: Human XR_246113.3

PREDICTED: Homo sapiens B-TFIID TATA-box binding protein associated factor 1 (BTAF1), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BTAF1 (9044)
Length:
4539
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_246113.3
NBCI Gene record:
BTAF1 (9044)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_246113.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013345 GCCGAATTTGAAGTCCAAGAT pLKO.1 677 3UTR 100% 4.950 6.930 N BTAF1 n/a
2 TRCN0000274254 GCCGAATTTGAAGTCCAAGAT pLKO_005 677 3UTR 100% 4.950 6.930 N BTAF1 n/a
3 TRCN0000274318 GAAACTCTGTTTACGTTATTA pLKO_005 1922 3UTR 100% 15.000 10.500 N BTAF1 n/a
4 TRCN0000013344 CGCCAACATTAACAGGCCATT pLKO.1 4413 3UTR 100% 4.050 2.835 N BTAF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_246113.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000473265 CTGACTACCTTCCTCTTTTGTCCC pLX_317 9.5% 69.2% V5 (many diffs) n/a
Download CSV