Transcript: Human XR_247219.2

PREDICTED: Homo sapiens copper chaperone for superoxide dismutase (CCS), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCS (9973)
Length:
1274
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_247219.2
NBCI Gene record:
CCS (9973)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_247219.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049080 TGCCTCATCGAGGGAACTATT pLKO.1 437 3UTR 100% 13.200 10.560 N CCS n/a
2 TRCN0000049082 GACCCTCTGCACGTTGGAGTT pLKO.1 127 3UTR 100% 1.350 1.080 N CCS n/a
3 TRCN0000443938 GTGGTGTTCCCTTGGCAAATG pLKO_005 1232 3UTR 100% 10.800 7.560 N CCS n/a
4 TRCN0000049081 GCCATCCCTTATCCAAGATCA pLKO.1 917 3UTR 100% 4.950 3.465 N CCS n/a
5 TRCN0000049079 GTCTTGGTACACACCACTCTA pLKO.1 251 3UTR 100% 4.950 3.465 N CCS n/a
6 TRCN0000433789 GTCTTTGGAGAGCTCAGTACA pLKO_005 1197 3UTR 100% 4.950 3.465 N CCS n/a
7 TRCN0000049078 CTGATTATTGATGAGGGAGAA pLKO.1 877 3UTR 100% 4.050 2.835 N CCS n/a
8 TRCN0000421757 GGTTGGCCTGTGGCATCATTG pLKO_005 956 3UTR 100% 3.600 2.520 N CCS n/a
9 TRCN0000426021 CAACAGCTGTGGGAATCACTT pLKO_005 523 3UTR 100% 4.950 2.970 N CCS n/a
10 TRCN0000101231 CTTATCCAAGATCACAGGGAA pLKO.1 924 3UTR 100% 2.640 1.584 N Ccs n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_247219.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.