Transcript: Mouse XR_374487.3

PREDICTED: Mus musculus kinetochore-localized astrin/SPAG5 binding (Knstrn), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Knstrn (51944)
Length:
1434
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_374487.3
NBCI Gene record:
Knstrn (51944)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_374487.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201497 CCTTATGTAAGGACGAAGCCA pLKO.1 979 3UTR 100% 0.750 1.050 N Knstrn n/a
2 TRCN0000319897 CCTTATGTAAGGACGAAGCCA pLKO_005 979 3UTR 100% 0.750 1.050 N Knstrn n/a
3 TRCN0000216519 GACTTCACAATAATCCTAGAG pLKO.1 1002 3UTR 100% 4.050 3.240 N Knstrn n/a
4 TRCN0000192624 GCTGCGGAGCATTATTTGAAA pLKO.1 258 3UTR 100% 5.625 3.938 N Knstrn n/a
5 TRCN0000350130 GCTGCGGAGCATTATTTGAAA pLKO_005 258 3UTR 100% 5.625 3.938 N Knstrn n/a
6 TRCN0000217293 GCGGATTTGCTTAGACATCTT pLKO.1 459 3UTR 100% 4.950 3.465 N Knstrn n/a
7 TRCN0000200854 GCTACTTCTAAACTACCTGTT pLKO.1 426 3UTR 100% 4.050 2.835 N Knstrn n/a
8 TRCN0000319827 GCTACTTCTAAACTACCTGTT pLKO_005 426 3UTR 100% 4.050 2.835 N Knstrn n/a
9 TRCN0000191452 CTCGAAACTTTGAAAGACGAA pLKO.1 849 3UTR 100% 2.640 1.848 N Knstrn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_374487.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.