Transcript: Mouse XR_374538.3

PREDICTED: Mus musculus tocopherol (alpha) transfer protein-like (Ttpal), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ttpal (76080)
Length:
4699
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_374538.3
NBCI Gene record:
Ttpal (76080)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_374538.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105394 TGAACGAACCTCGGATATTTA pLKO.1 829 3UTR 100% 15.000 21.000 N Ttpal n/a
2 TRCN0000105392 CCCTGAAAGACGTTCTCAACT pLKO.1 511 3UTR 100% 4.950 3.960 N Ttpal n/a
3 TRCN0000105391 GCAGTTCACATAGTGAACGAA pLKO.1 816 3UTR 100% 0.300 0.240 N Ttpal n/a
4 TRCN0000105393 GACAGAAGACTTGGTCACCAA pLKO.1 257 3UTR 100% 2.640 1.848 N Ttpal n/a
5 TRCN0000105390 CCAGCTCTACTCCTGCTATTA pLKO.1 1306 3UTR 100% 13.200 7.920 N Ttpal n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_374538.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04068 pDONR223 100% 19.1% None (many diffs) n/a
2 ccsbBroad304_04068 pLX_304 0% 19.1% V5 (many diffs) n/a
3 TRCN0000477495 CAATTCCTTCCACCCTTGCTGATA pLX_317 38.4% 19.1% V5 (many diffs) n/a
Download CSV