Transcript: Mouse XR_376340.3

PREDICTED: Mus musculus tRNA isopentenyltransferase 1 (Trit1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trit1 (66966)
Length:
1905
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_376340.3
NBCI Gene record:
Trit1 (66966)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_376340.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329236 CGAGGCACAGATCGCACATTT pLKO_005 1502 3UTR 100% 13.200 18.480 N Trit1 n/a
2 TRCN0000111291 CGGCCCTGATTGAAGATATTT pLKO.1 384 3UTR 100% 15.000 12.000 N Trit1 n/a
3 TRCN0000375362 CTAGATGAGCGCTTGGATAAA pLKO_005 782 3UTR 100% 13.200 10.560 N Trit1 n/a
4 TRCN0000375360 AGATTCAGTGCATCCTTTAAA pLKO_005 1557 3UTR 100% 15.000 10.500 N Trit1 n/a
5 TRCN0000375310 GCTAGACATCATCACCAATAA pLKO_005 262 3UTR 100% 13.200 9.240 N Trit1 n/a
6 TRCN0000111293 CCAGTGAAGATGGCATACAAT pLKO.1 991 3UTR 100% 5.625 3.938 N Trit1 n/a
7 TRCN0000111290 GCAGAGAGATGATTAAGCAAA pLKO.1 1700 3UTR 100% 4.950 3.465 N Trit1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_376340.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12085 pDONR223 100% 30.3% None (many diffs) n/a
2 ccsbBroad304_12085 pLX_304 0% 30.3% V5 (many diffs) n/a
3 TRCN0000465214 TTTTAGCCTGGCGAAAACTGCTGC pLX_317 2.2% 30.3% V5 (many diffs) n/a
Download CSV