Transcript: Mouse XR_376349.2

PREDICTED: Mus musculus target of EGR1, member 1 (nuclear) (Toe1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Toe1 (68276)
Length:
1373
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_376349.2
NBCI Gene record:
Toe1 (68276)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_376349.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241103 TAGAATACGCTTTCCGGAAAT pLKO_005 847 3UTR 100% 10.800 15.120 N Toe1 n/a
2 TRCN0000195788 CAGCAACCAGATAAGGGTGAA pLKO.1 435 3UTR 100% 4.050 5.670 N Toe1 n/a
3 TRCN0000339269 GTGCTACATAATGGCCTTATA pLKO_005 678 3UTR 100% 13.200 10.560 N Toe1 n/a
4 TRCN0000241102 ACACGATATTGACCTTATAAT pLKO_005 1179 3UTR 100% 15.000 10.500 N Toe1 n/a
5 TRCN0000339198 GACAAACGGAAGAGGTCTTTA pLKO_005 1252 3UTR 100% 13.200 9.240 N Toe1 n/a
6 TRCN0000217481 GCATAGAGGAGTACGTTATAG pLKO.1 496 3UTR 100% 13.200 9.240 N Toe1 n/a
7 TRCN0000241099 GCATAGAGGAGTACGTTATAG pLKO_005 496 3UTR 100% 13.200 9.240 N Toe1 n/a
8 TRCN0000217937 GGTGTTCCTGTACCAGAATTT pLKO.1 704 3UTR 100% 13.200 9.240 N Toe1 n/a
9 TRCN0000339200 GTGTTCCTGTACCAGAATTTC pLKO_005 705 3UTR 100% 13.200 9.240 N Toe1 n/a
10 TRCN0000339267 TGTTCCCAGCAGGCATCTATG pLKO_005 778 3UTR 100% 10.800 7.560 N Toe1 n/a
11 TRCN0000155380 CCTACCATAAGGGCAATGACA pLKO.1 586 3UTR 100% 3.000 1.800 N TOE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_376349.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487726 GTCGCGGCATACTTTTCTTTACAG pLX_317 18.4% 56.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV