Transcript: Mouse XR_377056.2

PREDICTED: Mus musculus splicing factor, suppressor of white-apricot homolog (Drosophila) (Sfswap), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sfswap (231769)
Length:
3441
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_377056.2
NBCI Gene record:
Sfswap (231769)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_377056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277508 ACTTACGGCAGCGACTATTAT pLKO_005 600 3UTR 100% 15.000 21.000 N Sfswap n/a
2 TRCN0000277507 GTCGCTAGAAACGGCCTTAAA pLKO_005 1542 3UTR 100% 13.200 18.480 N Sfswap n/a
3 TRCN0000216210 CGTTGTTCTTACAAACCTTAA pLKO.1 2200 3UTR 100% 10.800 15.120 N Sfswap n/a
4 TRCN0000178201 CAAGATCCTCATCGACAGATA pLKO.1 347 3UTR 100% 4.950 6.930 N Sfswap n/a
5 TRCN0000181277 CACAGCCAACTTCGTATGCAA pLKO.1 788 3UTR 100% 3.000 4.200 N Sfswap n/a
6 TRCN0000178400 GAGAGGTATTTAGCCTTGCAT pLKO.1 483 3UTR 100% 3.000 4.200 N Sfswap n/a
7 TRCN0000181638 GCTGTGTGATGAAGAGAGGTA pLKO.1 470 3UTR 100% 2.640 3.432 N Sfswap n/a
8 TRCN0000285984 GCTGTGTGATGAAGAGAGGTA pLKO_005 470 3UTR 100% 2.640 3.432 N Sfswap n/a
9 TRCN0000198707 CGACTATTATGACCCGTCAGA pLKO.1 611 3UTR 100% 2.640 2.112 N Sfswap n/a
10 TRCN0000178566 CTGTGTGATGAAGAGAGGTAT pLKO.1 471 3UTR 100% 4.950 3.465 N Sfswap n/a
11 TRCN0000221599 CTGTGTGATGAAGAGAGGTAT pLKO.1 471 3UTR 100% 4.950 3.465 N SFSWAP n/a
12 TRCN0000277580 TGCCGACCTACATGCAGCTAT pLKO_005 3247 3UTR 100% 4.950 3.465 N Sfswap n/a
13 TRCN0000181797 GAGCAAGAACGAGGAGAAGAA pLKO.1 956 3UTR 100% 4.950 2.970 N Sfswap n/a
14 TRCN0000277578 GAGCAAGAACGAGGAGAAGAA pLKO_005 956 3UTR 100% 4.950 2.970 N Sfswap n/a
15 TRCN0000153398 GAAGAGGAAGATGATGAGGAT pLKO.1 1002 3UTR 100% 2.640 1.320 Y NPM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_377056.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.