Transcript: Mouse XR_377439.2

PREDICTED: Mus musculus FK506 binding protein 14 (Fkbp14), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fkbp14 (231997)
Length:
3352
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_377439.2
NBCI Gene record:
Fkbp14 (231997)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_377439.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111838 CCACGAGTCGTTTCAAGAAAT pLKO.1 1075 3UTR 100% 13.200 18.480 N Fkbp14 n/a
2 TRCN0000055902 GCCATTCATCTGCCATCGCAA pLKO.1 757 3UTR 100% 2.640 3.696 N FKBP14 n/a
3 TRCN0000307720 GCCATTCATCTGCCATCGCAA pLKO_005 757 3UTR 100% 2.640 3.696 N FKBP14 n/a
4 TRCN0000111839 GATTTATATCTGCCAGAGAAT pLKO.1 1380 3UTR 100% 4.950 3.960 N Fkbp14 n/a
5 TRCN0000111837 CCTGTTTCATTCCACTCACAA pLKO.1 838 3UTR 100% 4.950 3.465 N Fkbp14 n/a
6 TRCN0000111835 CCTTGTAATCAACACACCAAA pLKO.1 2050 3UTR 100% 4.950 3.465 N Fkbp14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_377439.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03510 pDONR223 100% 16.5% None (many diffs) n/a
2 ccsbBroad304_03510 pLX_304 0% 16.5% V5 (many diffs) n/a
3 TRCN0000470365 GCTAATTGACTTTGCAATCGACCT pLX_317 75.6% 16.5% V5 (many diffs) n/a
Download CSV