Transcript: Mouse XR_378910.2

PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 7 (Cnot7), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cnot7 (18983)
Length:
3615
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_378910.2
NBCI Gene record:
Cnot7 (18983)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_378910.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095976 GCTCGGACTGACCTTTATGAA pLKO.1 1430 3UTR 100% 5.625 7.875 N Cnot7 n/a
2 TRCN0000095977 GAACGTCAACTTGGCAGTTTA pLKO.1 1474 3UTR 100% 13.200 10.560 N Cnot7 n/a
3 TRCN0000017869 GCTACTAACAACATCTGGTAT pLKO.1 1544 3UTR 100% 4.950 3.960 N CNOT7 n/a
4 TRCN0000095978 CCAAATACTGTGGTCACTTAT pLKO.1 2069 3UTR 100% 13.200 9.240 N Cnot7 n/a
5 TRCN0000095974 CCTTCTATTCTGCAGTACTTA pLKO.1 2508 3UTR 100% 5.625 3.938 N Cnot7 n/a
6 TRCN0000017868 CGGTGTAATGTAGACTTGTTA pLKO.1 1398 3UTR 100% 5.625 3.938 N CNOT7 n/a
7 TRCN0000318847 CGGTGTAATGTAGACTTGTTA pLKO_005 1398 3UTR 100% 5.625 3.938 N CNOT7 n/a
8 TRCN0000095975 GCGGTGTAATGTAGACTTGTT pLKO.1 1397 3UTR 100% 4.950 3.465 N Cnot7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_378910.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03097 pDONR223 100% 22% None (many diffs) n/a
2 ccsbBroad304_03097 pLX_304 0% 22% V5 (many diffs) n/a
3 TRCN0000466126 TCGAGCCATATCGGGGGAGGTCTG pLX_317 43.4% 22% V5 (many diffs) n/a
4 ccsbBroadEn_11909 pDONR223 100% 18.9% None (many diffs) n/a
5 ccsbBroad304_11909 pLX_304 0% 18.9% V5 (many diffs) n/a
6 TRCN0000475112 AAGTTTTCGTATTTGATCATCATC pLX_317 49.3% 18.9% V5 (many diffs) n/a
Download CSV