Transcript: Mouse XR_379756.3

PREDICTED: Mus musculus macrophage stimulating 1 receptor (c-met-related tyrosine kinase) (Mst1r), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mst1r (19882)
Length:
3780
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_379756.3
NBCI Gene record:
Mst1r (19882)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_379756.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361456 GGTGTCCATCCGTCGTCTAAA pLKO_005 934 3UTR 100% 13.200 10.560 N Mst1r n/a
2 TRCN0000361459 TTGAAGAGGGTGTCGAATATT pLKO_005 1422 3UTR 100% 15.000 10.500 N Mst1r n/a
3 TRCN0000023546 GCCTACGAGGACAGTACAAAT pLKO.1 470 3UTR 100% 13.200 9.240 N Mst1r n/a
4 TRCN0000361457 TCAATGAGGAGCAGATCTTAT pLKO_005 2478 3UTR 100% 13.200 9.240 N Mst1r n/a
5 TRCN0000361458 TGTTGTCTACCACGGAGAATA pLKO_005 3438 3UTR 100% 13.200 9.240 N Mst1r n/a
6 TRCN0000023547 CCTGCTGTATGTGTCCAACTT pLKO.1 1738 3UTR 100% 4.950 3.465 N Mst1r n/a
7 TRCN0000023544 GCCTGAATATGTGGTCCGAAA pLKO.1 2779 3UTR 100% 4.050 2.835 N Mst1r n/a
8 TRCN0000023545 CCCTGATCTTTAACTCCCGAA pLKO.1 3225 3UTR 100% 2.160 1.512 N Mst1r n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_379756.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.