Transcript: Mouse XR_379934.3

PREDICTED: Mus musculus predicted pseudogene 9385 (Gm9385), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm9385 (668829)
Length:
593
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_379934.3
NBCI Gene record:
Gm9385 (668829)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_379934.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117643 GTGCATCTCTTGCTGATATAA pLKO.1 311 3UTR 100% 15.000 7.500 Y RPL24 n/a
2 TRCN0000300643 GTGCATCTCTTGCTGATATAA pLKO_005 311 3UTR 100% 15.000 7.500 Y RPL24 n/a
3 TRCN0000104248 TGGTGCATCTCTTGCTGATAT pLKO.1 309 3UTR 100% 13.200 6.600 Y Rpl24 n/a
4 TRCN0000104245 CCTCTACAGAAGGAAACACAA pLKO.1 219 3UTR 100% 4.950 2.475 Y Rpl24 n/a
5 TRCN0000104247 CTGGTGCATCTCTTGCTGATA pLKO.1 308 3UTR 100% 4.950 2.475 Y Rpl24 n/a
6 TRCN0000104249 GAGTCAGCATTCCTTTCCAAA pLKO.1 169 3UTR 100% 4.950 2.475 Y Rpl24 n/a
7 TRCN0000104246 GCCAGGACCGACGGGAAGGTT pLKO.1 124 3UTR 100% 0.000 0.000 Y Rpl24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_379934.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01427 pDONR223 98.7% 72.7% None (many diffs) n/a
2 ccsbBroad304_01427 pLX_304 0% 72.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000480508 AGCGTTACTCTGTCGTTGAGCCAT pLX_317 73.1% 72.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV