Transcript: Mouse XR_380076.3

PREDICTED: Mus musculus solute carrier family 16 (monocarboxylic acid transporters), member 10 (Slc16a10), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc16a10 (72472)
Length:
1674
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_380076.3
NBCI Gene record:
Slc16a10 (72472)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_380076.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079640 CTGGGATACCACTTGCACTTT pLKO.1 1114 3UTR 100% 4.950 3.465 N Slc16a10 n/a
2 TRCN0000079641 TGTGGGATTCATTGGACTCAT pLKO.1 671 3UTR 100% 4.950 3.465 N Slc16a10 n/a
3 TRCN0000079639 CGATGACAACATGGCCTTCAA pLKO.1 539 3UTR 100% 4.950 2.970 N Slc16a10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_380076.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13065 pDONR223 100% 23% None (many diffs) n/a
2 ccsbBroad304_13065 pLX_304 0% 23% V5 (many diffs) n/a
3 TRCN0000474056 CAGTCTAAAACTTGATTTTCAGAA pLX_317 49.6% 23% V5 (many diffs) n/a
Download CSV