Transcript: Mouse XR_382012.3

PREDICTED: Mus musculus ankyrin repeat and SOCS box-containing 13 (Asb13), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Asb13 (142688)
Length:
826
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_382012.3
NBCI Gene record:
Asb13 (142688)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_382012.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217877 GAATGCGTGAGGCTTCTTATT pLKO.1 511 3UTR 100% 13.200 9.240 N Asb13 n/a
2 TRCN0000190797 GAAAGTCAACCCTCCTTTGTA pLKO.1 447 3UTR 100% 5.625 3.938 N Asb13 n/a
3 TRCN0000319783 GAAAGTCAACCCTCCTTTGTA pLKO_005 447 3UTR 100% 5.625 3.938 N Asb13 n/a
4 TRCN0000189813 GCAGCCAAGGTAAAGAACGTT pLKO.1 782 3UTR 100% 3.000 2.100 N Asb13 n/a
5 TRCN0000350185 GCAGCCAAGGTAAAGAACGTT pLKO_005 782 3UTR 100% 3.000 2.100 N Asb13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_382012.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10251 pDONR223 100% 55% None (many diffs) n/a
2 ccsbBroad304_10251 pLX_304 0% 55% V5 (many diffs) n/a
3 TRCN0000481338 TGACCTCCATATCCGCAGTGCCGC pLX_317 92.5% 55% V5 (many diffs) n/a
Download CSV