Transcript: Mouse XR_382737.3

PREDICTED: Mus musculus solute carrier family 38, member 9 (Slc38a9), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc38a9 (268706)
Length:
8817
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_382737.3
NBCI Gene record:
Slc38a9 (268706)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_382737.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429642 CATTGGAGCAATGATAGTTTA pLKO_005 778 3UTR 100% 13.200 9.240 N SLC38A9 n/a
2 TRCN0000101970 GCCTTGTATCAAGACACTAAA pLKO.1 2521 3UTR 100% 13.200 9.240 N Slc38a9 n/a
3 TRCN0000101971 CGCCTCCATTACCCAAAGATT pLKO.1 1294 3UTR 100% 5.625 3.938 N Slc38a9 n/a
4 TRCN0000101972 GCTGCTATGAACAAGCGGATT pLKO.1 335 3UTR 100% 4.050 2.835 N Slc38a9 n/a
5 TRCN0000101974 CGGTGACATTTATCCTAGCAT pLKO.1 1457 3UTR 100% 3.000 2.100 N Slc38a9 n/a
6 TRCN0000153429 GCATTGCTTATATGCTGGTGA pLKO.1 1225 3UTR 100% 2.640 1.848 N SLC38A9 n/a
7 TRCN0000101973 CCTGGCTTTCGTGTTCATATA pLKO.1 1586 3UTR 100% 13.200 7.920 N Slc38a9 n/a
8 TRCN0000150636 GCTTATATGCTGGTGACATTA pLKO.1 1230 3UTR 100% 13.200 10.560 N SLC38A9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_382737.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09693 pDONR223 100% 15.7% None (many diffs) n/a
2 ccsbBroad304_09693 pLX_304 0% 15.7% V5 (many diffs) n/a
Download CSV