Transcript: Mouse XR_383188.2

PREDICTED: Mus musculus RFT1 homolog (Rft1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rft1 (328370)
Length:
2301
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_383188.2
NBCI Gene record:
Rft1 (328370)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_383188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000345855 GCAGGTCTTGTTTCGATTAAT pLKO_005 133 3UTR 100% 15.000 21.000 N Rft1 n/a
2 TRCN0000249997 TTTGGCGATCAGGGTGTATAT pLKO_005 887 3UTR 100% 13.200 18.480 N Rft1 n/a
3 TRCN0000249999 GCCGCAAGAATGGTTAGTTTC pLKO_005 1908 3UTR 100% 10.800 15.120 N Rft1 n/a
4 TRCN0000216263 CTTTGAGTGTGATTGACCTTT pLKO.1 1803 3UTR 100% 4.950 6.930 N Rft1 n/a
5 TRCN0000181781 GCTTTACTCAACCACAACCTT pLKO.1 232 3UTR 100% 3.000 4.200 N Rft1 n/a
6 TRCN0000249998 ACTGTCCCACTGGGTATATTT pLKO_005 338 3UTR 100% 15.000 10.500 N Rft1 n/a
7 TRCN0000345932 CACAACTGTTGCCCAGTATTT pLKO_005 738 3UTR 100% 13.200 9.240 N Rft1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_383188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.