Transcript: Mouse XR_383217.3

PREDICTED: Mus musculus M-phase phosphoprotein 8 (Mphosph8), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mphosph8 (75339)
Length:
2834
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_383217.3
NBCI Gene record:
Mphosph8 (75339)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_383217.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085438 CCTACCTAGTTGTAAACTTAA pLKO.1 2666 3UTR 100% 13.200 18.480 N Mphosph8 n/a
2 TRCN0000085441 GCGAGGGAGGTAAGAATCTTT pLKO.1 324 3UTR 100% 5.625 4.500 N Mphosph8 n/a
3 TRCN0000331535 GCGAGGGAGGTAAGAATCTTT pLKO_005 324 3UTR 100% 5.625 4.500 N Mphosph8 n/a
4 TRCN0000085440 GCCAAGGTTAAGTTGCTAATA pLKO.1 2529 3UTR 100% 13.200 9.240 N Mphosph8 n/a
5 TRCN0000302162 GCCAAGGTTAAGTTGCTAATA pLKO_005 2529 3UTR 100% 13.200 9.240 N Mphosph8 n/a
6 TRCN0000085439 GCCGGATTTCTCAACAGATTT pLKO.1 2270 3UTR 100% 13.200 9.240 N Mphosph8 n/a
7 TRCN0000302163 GCCGGATTTCTCAACAGATTT pLKO_005 2270 3UTR 100% 13.200 9.240 N Mphosph8 n/a
8 TRCN0000085442 CACCTCTGAAATAATCGGTTT pLKO.1 682 3UTR 100% 4.050 2.835 N Mphosph8 n/a
9 TRCN0000302238 CACCTCTGAAATAATCGGTTT pLKO_005 682 3UTR 100% 4.050 2.835 N Mphosph8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_383217.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.