Transcript: Mouse XR_384563.3

PREDICTED: Mus musculus leishmanolysin-like (metallopeptidase M8 family) (Lmln), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lmln (239833)
Length:
6116
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_384563.3
NBCI Gene record:
Lmln (239833)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_384563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031217 CGGACACTGAGGTCATAAATA pLKO.1 855 3UTR 100% 15.000 21.000 N Lmln n/a
2 TRCN0000031215 CCGACTGTAGAATCCTGGAAA pLKO.1 2253 3UTR 100% 4.950 6.930 N Lmln n/a
3 TRCN0000031216 CCGCCCTTCAACTATAGTCTT pLKO.1 1559 3UTR 100% 4.950 3.960 N Lmln n/a
4 TRCN0000424225 TGCTAACCTGTGTCCAAATAT pLKO_005 1390 3UTR 100% 15.000 10.500 N LMLN n/a
5 TRCN0000031214 GCTGGCATTTAAGTGGCGAAT pLKO.1 2220 3UTR 100% 4.050 2.835 N Lmln n/a
6 TRCN0000031218 GCTTGTATCAGTGGAGTGATA pLKO.1 1581 3UTR 100% 0.495 0.347 N Lmln n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_384563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.