Transcript: Mouse XR_384568.1

PREDICTED: Mus musculus ATP-binding cassette, sub-family C (CFTR/MRP), member 5 (Abcc5), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abcc5 (27416)
Length:
5646
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_384568.1
NBCI Gene record:
Abcc5 (27416)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_384568.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111041 CGAGGAGCATTCTAAGGGAAA pLKO.1 413 3UTR 100% 4.050 5.670 N Abcc5 n/a
2 TRCN0000325250 CGAGGAGCATTCTAAGGGAAA pLKO_005 413 3UTR 100% 4.050 5.670 N Abcc5 n/a
3 TRCN0000111042 CGAAGGGTTGTGTGGATCTTT pLKO.1 696 3UTR 100% 5.625 4.500 N Abcc5 n/a
4 TRCN0000111044 CGGAGAACAAGATCGTTGGAA pLKO.1 309 3UTR 100% 3.000 2.400 N Abcc5 n/a
5 TRCN0000305973 GTGCATTCTCATCTCCAAATT pLKO_005 387 3UTR 100% 13.200 9.240 N Abcc5 n/a
6 TRCN0000305974 TGTGGCCTTTGTCCAAGTATG pLKO_005 592 3UTR 100% 10.800 7.560 N Abcc5 n/a
7 TRCN0000305972 GCCAAGATGCTCTCGAAACAG pLKO_005 331 3UTR 100% 4.950 3.465 N Abcc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_384568.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.