Transcript: Mouse XR_385303.3

PREDICTED: Mus musculus abhydrolase domain containing 16A (Abhd16a), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abhd16a (193742)
Length:
2056
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_385303.3
NBCI Gene record:
Abhd16a (193742)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_385303.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238273 AGCTCCTGGGATACGTATTAT pLKO_005 214 3UTR 100% 15.000 21.000 N Abhd16a n/a
2 TRCN0000031565 CGACTGGTGGAAGAGTGTAAT pLKO.1 817 3UTR 100% 13.200 10.560 N Abhd16a n/a
3 TRCN0000244280 AGAGGCAGCTGGCCAACTATA pLKO_005 518 3UTR 100% 13.200 9.240 N Abhd16a n/a
4 TRCN0000031567 CCCAGACATCAGTGCTGTTAT pLKO.1 1271 3UTR 100% 13.200 9.240 N Abhd16a n/a
5 TRCN0000031568 GCTAGAGGAAGCCTCCATTTA pLKO.1 1604 3UTR 100% 13.200 9.240 N Abhd16a n/a
6 TRCN0000238272 TCTTCTGGAAGGACAAGATAG pLKO_005 1859 3UTR 100% 10.800 7.560 N Abhd16a n/a
7 TRCN0000031564 CGGAAGCATCTACACAACTTT pLKO.1 1764 3UTR 100% 5.625 3.938 N Abhd16a n/a
8 TRCN0000031566 CTACTTATACAGGAAAGGTTA pLKO.1 330 3UTR 100% 4.950 3.465 N Abhd16a n/a
9 TRCN0000238270 CTTCTGGTCCATCTCTTATTA pLKO_005 288 3UTR 100% 15.000 9.000 N Abhd16a n/a
10 TRCN0000238271 TCTCACTATGCCGGGACATTG pLKO_005 379 3UTR 100% 10.800 6.480 N Abhd16a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_385303.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07188 pDONR223 100% 73.7% None (many diffs) n/a
2 ccsbBroad304_07188 pLX_304 0% 73.7% V5 (many diffs) n/a
3 TRCN0000475612 TCACCTTCGCCGACCGTTGCTGAG pLX_317 11% 73.7% V5 (many diffs) n/a
Download CSV