Transcript: Mouse XR_386478.1

PREDICTED: Mus musculus sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G (Sema4g), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sema4g (26456)
Length:
4704
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_386478.1
NBCI Gene record:
Sema4g (26456)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_386478.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375163 TGTTTCAACCACGTGCGATTT pLKO_005 1261 3UTR 100% 10.800 15.120 N Sema4g n/a
2 TRCN0000112323 CGGTATGAATTCCGGAGCATT pLKO.1 1471 3UTR 100% 0.000 0.000 N Sema4g n/a
3 TRCN0000317351 CGGTATGAATTCCGGAGCATT pLKO_005 1471 3UTR 100% 0.000 0.000 N Sema4g n/a
4 TRCN0000112320 CCAGATCAAGTGCTTACATTT pLKO.1 4044 3UTR 100% 13.200 9.240 N Sema4g n/a
5 TRCN0000317414 CCAGATCAAGTGCTTACATTT pLKO_005 4044 3UTR 100% 13.200 9.240 N Sema4g n/a
6 TRCN0000313830 GTCTGTGGACAATCTAGTTAT pLKO_005 2346 3UTR 100% 13.200 9.240 N Sema4g n/a
7 TRCN0000112324 GCAGCCTGAATGCTGATACAT pLKO.1 1829 3UTR 100% 5.625 3.938 N Sema4g n/a
8 TRCN0000112322 GCCTGAATGCTGATACATCAT pLKO.1 1832 3UTR 100% 4.950 3.465 N Sema4g n/a
9 TRCN0000112321 CGTAGCCAACAGGACAGAATT pLKO.1 2529 3UTR 100% 0.000 0.000 N Sema4g n/a
10 TRCN0000313831 CTCTCAGTGCCCGTGACATAA pLKO_005 1151 3UTR 100% 13.200 7.920 N Sema4g n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_386478.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15953 pDONR223 0% 37.5% None (many diffs) n/a
2 ccsbBroad304_15953 pLX_304 0% 37.5% V5 (many diffs) n/a
3 TRCN0000475425 CGATCATCTGTGATCATAAGCCCA pLX_317 10.8% 37.5% V5 (many diffs) n/a
Download CSV