Transcript: Mouse XR_386525.2

PREDICTED: Mus musculus sideroflexin 2 (Sfxn2), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sfxn2 (94279)
Length:
1456
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_386525.2
NBCI Gene record:
Sfxn2 (94279)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_386525.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105597 GTCCTCTTTGTCTACTTTAAT pLKO.1 1093 3UTR 100% 15.000 10.500 N Sfxn2 n/a
2 TRCN0000105599 CTGCCGCTAACTGTGTCAATA pLKO.1 710 3UTR 100% 13.200 9.240 N Sfxn2 n/a
3 TRCN0000105596 GCTCCAGTTCTACAGGACAAT pLKO.1 474 3UTR 100% 4.950 3.465 N Sfxn2 n/a
4 TRCN0000105598 CAAGTCCTCTTTGTCTACTTT pLKO.1 1090 3UTR 100% 5.625 3.375 N Sfxn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_386525.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04734 pDONR223 100% 57.4% None (many diffs) n/a
2 ccsbBroad304_04734 pLX_304 0% 57.4% V5 (many diffs) n/a
3 TRCN0000473648 CATCACTCCGAAACTTCTTTGTGG pLX_317 44.6% 57.4% V5 (many diffs) n/a
Download CSV