Transcript: Mouse XR_387197.3

PREDICTED: Mus musculus acyl-Coenzyme A binding domain containing 6 (Acbd6), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acbd6 (72482)
Length:
1654
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_387197.3
NBCI Gene record:
Acbd6 (72482)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_387197.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202124 CAGGATGGAATCCTCAGGTAT pLKO.1 908 3UTR 100% 4.950 6.930 N Acbd6 n/a
2 TRCN0000297648 CAGGATGGAATCCTCAGGTAT pLKO_005 908 3UTR 100% 4.950 6.930 N Acbd6 n/a
3 TRCN0000279278 CAGTATGAAGCTGGCATTAAT pLKO_005 1071 3UTR 100% 15.000 12.000 N Acbd6 n/a
4 TRCN0000201261 GCCAAGCAATGCAGGAATATA pLKO.1 863 3UTR 100% 15.000 12.000 N Acbd6 n/a
5 TRCN0000297649 GCCAAGCAATGCAGGAATATA pLKO_005 863 3UTR 100% 15.000 12.000 N Acbd6 n/a
6 TRCN0000279277 TTTCGGTGGTCCGGTTGTTAG pLKO_005 960 3UTR 100% 10.800 7.560 N Acbd6 n/a
7 TRCN0000201950 CTAGCCAAGCAATGCAGGAAT pLKO.1 860 3UTR 100% 4.950 3.465 N Acbd6 n/a
8 TRCN0000189852 GCTACAGTATGAAGCTGGCAT pLKO.1 1067 3UTR 100% 2.640 1.848 N Acbd6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_387197.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04376 pDONR223 100% 36% None (many diffs) n/a
2 ccsbBroad304_04376 pLX_304 0% 36% V5 (many diffs) n/a
3 TRCN0000477142 TTTTTGTCGTAGCTTACGCACTCA pLX_317 45.4% 36% V5 (many diffs) n/a
Download CSV