Transcript: Mouse XR_387762.3

PREDICTED: Mus musculus dihydroorotate dehydrogenase (Dhodh), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dhodh (56749)
Length:
2198
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_387762.3
NBCI Gene record:
Dhodh (56749)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_387762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041436 CGACCATTTCTACGCCGAGTA pLKO.1 430 3UTR 100% 4.050 5.670 N Dhodh n/a
2 TRCN0000287215 CGACCATTTCTACGCCGAGTA pLKO_005 430 3UTR 100% 4.050 5.670 N Dhodh n/a
3 TRCN0000041433 GCAGACTATGTAGAGGGTGTT pLKO.1 905 3UTR 100% 4.050 5.670 N Dhodh n/a
4 TRCN0000041437 CGGACTCTATAAGCTGGGCTT pLKO.1 646 3UTR 100% 2.160 3.024 N Dhodh n/a
5 TRCN0000294665 CCACTGTCTCTAGATCTAAAT pLKO_005 1551 3UTR 100% 13.200 10.560 N Dhodh n/a
6 TRCN0000041434 CCTGGGCCATAAATTCCGAAA pLKO.1 577 3UTR 100% 4.050 3.240 N Dhodh n/a
7 TRCN0000294664 GAGGACCAAGCTGTTATTAAC pLKO_005 743 3UTR 100% 13.200 9.240 N Dhodh n/a
8 TRCN0000294666 TGAGCTGGAGGCCCTTCTAAA pLKO_005 1290 3UTR 100% 13.200 9.240 N Dhodh n/a
9 TRCN0000294663 TGGGCTGCCTCTGGGAATAAA pLKO_005 850 3UTR 100% 15.000 9.000 N Dhodh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_387762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06099 pDONR223 100% 37.4% None (many diffs) n/a
2 ccsbBroad304_06099 pLX_304 0% 37.4% V5 (many diffs) n/a
3 TRCN0000479627 ACCAATCCGTCTCGCCCAGGGCAA pLX_317 25.6% 37.4% V5 (many diffs) n/a
Download CSV