Transcript: Mouse XR_388388.3

PREDICTED: Mus musculus family with sequence similarity 20, member A (Fam20a), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam20a (208659)
Length:
2822
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_388388.3
NBCI Gene record:
Fam20a (208659)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_388388.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192208 CGGCACAAGATATACAAAGAA pLKO.1 1203 3UTR 100% 5.625 7.875 N Fam20a n/a
2 TRCN0000189483 CCTCCATGACATGAGACACTT pLKO.1 1349 3UTR 100% 4.950 3.465 N Fam20a n/a
3 TRCN0000191803 GATGGATACCTTATTCATCTT pLKO.1 2089 3UTR 100% 4.950 3.465 N Fam20a n/a
4 TRCN0000192354 CTGAACCTCATCTTTATCCTT pLKO.1 2606 3UTR 100% 3.000 2.100 N Fam20a n/a
5 TRCN0000190307 CCTGAAATTGGTTCTGAGGTT pLKO.1 1460 3UTR 100% 2.640 1.848 N Fam20a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_388388.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10241 pDONR223 100% 23.4% None (many diffs) n/a
2 ccsbBroad304_10241 pLX_304 0% 23.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471075 AACATTTGACGGCCCAAGCCAGCC pLX_317 66.7% 23.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV