Transcript: Mouse XR_389955.1

PREDICTED: Mus musculus RIKEN cDNA 5830411N06 gene (5830411N06Rik), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
5830411N06Rik (244234)
Length:
3483
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_389955.1
NBCI Gene record:
5830411N06Rik (244234)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_389955.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427126 AGAGCCCACGATGGAACTAAC pLKO_005 658 3UTR 100% 10.800 15.120 N 5830411N06Rik n/a
2 TRCN0000125833 CTAGAGGTTCTTAGAGGACTT pLKO.1 853 3UTR 100% 4.050 3.240 N 5830411N06Rik n/a
3 TRCN0000425790 GAGTTTCCTGGGCGGTGATAA pLKO_005 189 3UTR 100% 13.200 9.240 N 5830411N06Rik n/a
4 TRCN0000125831 GCTGTGGCTCTGTGAAGTTTA pLKO.1 314 3UTR 100% 13.200 9.240 N 5830411N06Rik n/a
5 TRCN0000415511 ACAGAGGCCTTTCGCTGTATG pLKO_005 1006 3UTR 100% 10.800 7.560 N 5830411N06Rik n/a
6 TRCN0000125829 CCAACAAGATTGTGGGCACAA pLKO.1 2010 3UTR 100% 4.050 2.835 N 5830411N06Rik n/a
7 TRCN0000125832 GTTCCCACTTTGGCTATGGAT pLKO.1 971 3UTR 100% 3.000 2.100 N 5830411N06Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_389955.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.