Transcript: Mouse XR_390722.1

PREDICTED: Mus musculus Rap1 GTPase-activating protein (Rap1gap), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rap1gap (110351)
Length:
3428
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_390722.1
NBCI Gene record:
Rap1gap (110351)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_390722.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054977 GCCGAGTATGCGTGTTACAAA pLKO.1 1422 3UTR 100% 5.625 7.875 N Rap1gap n/a
2 TRCN0000334516 GCCGAGTATGCGTGTTACAAA pLKO_005 1422 3UTR 100% 5.625 7.875 N Rap1gap n/a
3 TRCN0000054974 CCTGGTATTCTCGCTCAAGTA pLKO.1 641 3UTR 100% 4.950 6.930 N Rap1gap n/a
4 TRCN0000351271 CCTGGTATTCTCGCTCAAGTA pLKO_005 641 3UTR 100% 4.950 6.930 N Rap1gap n/a
5 TRCN0000054975 CGAGTCTTTCAAGAGGGTCAT pLKO.1 1592 3UTR 100% 4.050 3.240 N Rap1gap n/a
6 TRCN0000334542 CGAGTCTTTCAAGAGGGTCAT pLKO_005 1592 3UTR 100% 4.050 3.240 N Rap1gap n/a
7 TRCN0000054973 CCAGTATCCTTGGTTGTGGAT pLKO.1 3103 3UTR 100% 2.640 1.848 N Rap1gap n/a
8 TRCN0000309892 CCAGTATCCTTGGTTGTGGAT pLKO_005 3103 3UTR 100% 2.640 1.848 N Rap1gap n/a
9 TRCN0000054976 CCCTACCCTAAGAACACAGAT pLKO.1 279 3UTR 100% 4.950 2.970 N Rap1gap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_390722.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.