Transcript: Mouse XR_391236.3

PREDICTED: Mus musculus predicted gene 6579 (Gm6579), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm6579 (625349)
Length:
1665
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_391236.3
NBCI Gene record:
Gm6579 (625349)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_391236.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426242 ACATCATGGTTCTCAATTAAT pLKO_005 1324 3UTR 100% 15.000 7.500 Y Set n/a
2 TRCN0000425634 ATCAGGTTACAGAATAGATTT pLKO_005 712 3UTR 100% 13.200 6.600 Y Set n/a
3 TRCN0000077187 GCAAGAAGCAATTGAACATAT pLKO.1 439 3UTR 100% 13.200 6.600 Y Set n/a
4 TRCN0000120702 CCTGTGTAGTAGTTTATAGAA pLKO.1 1515 3UTR 100% 5.625 2.813 Y BC085271 n/a
5 TRCN0000077183 CCAACATGTATCTGTCTACTT pLKO.1 1618 3UTR 100% 4.950 2.475 Y Set n/a
6 TRCN0000063715 CCAGAGTTGAAGTGACAGAAT pLKO.1 678 3UTR 100% 4.950 2.475 Y SET n/a
7 TRCN0000288673 CCAGAGTTGAAGTGACAGAAT pLKO_005 678 3UTR 100% 4.950 2.475 Y SET n/a
8 TRCN0000077184 CCCGACATGGATGATGAAGAA pLKO.1 1022 3UTR 100% 4.950 2.475 Y Set n/a
9 TRCN0000077186 GAGAGCTTCTTTACCTGGTTT pLKO.1 914 3UTR 100% 4.950 2.475 Y Set n/a
10 TRCN0000120703 GTGACAGAATTTGAAGACATT pLKO.1 689 3UTR 100% 4.950 2.475 Y BC085271 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_391236.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01519 pDONR223 100% 44.4% None (many diffs) n/a
2 ccsbBroad304_01519 pLX_304 0% 44.4% V5 (many diffs) n/a
3 TRCN0000474477 TCAGCCTACCATCAACTTCGTATT pLX_317 68% 44.4% V5 (many diffs) n/a
Download CSV