Transcript: Mouse XR_868877.1

PREDICTED: Mus musculus plexin D1 (Plxnd1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plxnd1 (67784)
Length:
5836
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_868877.1
NBCI Gene record:
Plxnd1 (67784)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_868877.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314143 GACCGTACAGCGCTATTATAA pLKO_005 5749 3UTR 100% 15.000 21.000 N Plxnd1 n/a
2 TRCN0000350171 TCTACGACTGCAGCCGAATTG pLKO_005 2297 3UTR 100% 10.800 15.120 N Plxnd1 n/a
3 TRCN0000078775 CCGGAACTTGAACGTGTCCTT pLKO.1 4860 3UTR 100% 2.640 3.696 N Plxnd1 n/a
4 TRCN0000078777 CCTGTAGACTTCTTCATCAAT pLKO.1 3607 3UTR 100% 5.625 3.938 N Plxnd1 n/a
5 TRCN0000061550 CCTCACGGACAACTACAACAA pLKO.1 558 3UTR 100% 4.950 3.465 N PLXND1 n/a
6 TRCN0000078776 CGAGCAGTTCTTCGCTGTCTT pLKO.1 1296 3UTR 100% 4.950 3.465 N Plxnd1 n/a
7 TRCN0000078774 CGGCTCAGTGATGTGGCACAT pLKO.1 2956 3UTR 100% 1.350 0.945 N Plxnd1 n/a
8 TRCN0000317940 CGGCTCAGTGATGTGGCACAT pLKO_005 2956 3UTR 100% 1.350 0.945 N Plxnd1 n/a
9 TRCN0000350170 ACGGCAAGCTGGAGTACTATA pLKO_005 4553 3UTR 100% 13.200 7.920 N Plxnd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_868877.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.