Transcript: Mouse XR_872527.1

PREDICTED: Mus musculus BCL2/adenovirus E1B interacting protein 3-like, pseudogene (Bnip3l-ps), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bnip3l-ps (100043324)
Length:
1229
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_872527.1
NBCI Gene record:
Bnip3l-ps (100043324)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_872527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425883 CAATGCCACCAGCAGATTATA pLKO_005 969 3UTR 100% 15.000 7.500 Y Bnip3l n/a
2 TRCN0000009731 CCCACCCAAAGAGTTCCATTT pLKO.1 500 3UTR 100% 10.800 5.400 Y Bnip3l n/a
3 TRCN0000412807 TAAACGTGCTGCGTCTCTAAG pLKO_005 530 3UTR 100% 10.800 5.400 Y Bnip3l n/a
4 TRCN0000009733 GATGGGCAGATCATGTTTGAT pLKO.1 348 3UTR 100% 5.625 2.813 Y Bnip3l n/a
5 TRCN0000007847 CAGTCAGAAGAAGAAGTTGTA pLKO.1 402 3UTR 100% 4.950 2.475 Y BNIP3L n/a
6 TRCN0000293518 CAGTCAGAAGAAGAAGTTGTA pLKO_005 402 3UTR 100% 4.950 2.475 Y BNIP3L n/a
7 TRCN0000009730 GCTCGGCATCTATATTGGAAA pLKO.1 653 3UTR 100% 4.950 2.475 Y Bnip3l n/a
8 TRCN0000009732 GCAATGGCAATGAGAATGGAA pLKO.1 178 3UTR 100% 3.000 1.500 Y Bnip3l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_872527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00171 pDONR223 100% 48.2% None (many diffs) n/a
2 ccsbBroad304_00171 pLX_304 0% 48.2% V5 (many diffs) n/a
3 TRCN0000467222 AGAGGCTATGTACACTGCCGAGAG pLX_317 56.2% 48.2% V5 (many diffs) n/a
Download CSV