Transcript: Mouse XR_875291.2

PREDICTED: Mus musculus Rap guanine nucleotide exchange factor (GEF) 3 (Rapgef3), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rapgef3 (223864)
Length:
2844
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_875291.2
NBCI Gene record:
Rapgef3 (223864)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_875291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271700 TAGAGAACCTCATCAACTTTG pLKO_005 2740 3UTR 100% 10.800 15.120 N Rapgef3 n/a
2 TRCN0000281824 TCTGCGACTATATCGGCATTG pLKO_005 546 3UTR 100% 6.000 8.400 N Rapgef3 n/a
3 TRCN0000071954 CACGGCAAAGTGGTCTTAGTT pLKO.1 1255 3UTR 100% 5.625 7.875 N Rapgef3 n/a
4 TRCN0000281825 TCTGGAAGGGATCTGTCAATG pLKO_005 1037 3UTR 100% 10.800 7.560 N Rapgef3 n/a
5 TRCN0000071955 CGCCTCTATCACCACTCAGAA pLKO.1 2824 3UTR 100% 4.950 3.465 N Rapgef3 n/a
6 TRCN0000071953 GCTACTCAGGAAGTTCATCAA pLKO.1 2441 3UTR 100% 4.950 3.465 N Rapgef3 n/a
7 TRCN0000071956 GCCACCATCATCCTTCGAGAA pLKO.1 1147 3UTR 100% 4.050 2.835 N Rapgef3 n/a
8 TRCN0000071957 CTTAGCAACTTGCTGAGGGAA pLKO.1 1696 3UTR 100% 2.640 1.848 N Rapgef3 n/a
9 TRCN0000336560 AGGTGTTGGTGAAGGTCAATT pLKO_005 1985 3UTR 100% 13.200 7.920 N Rapgef3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_875291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11494 pDONR223 100% 29.3% None (many diffs) n/a
2 ccsbBroad304_11494 pLX_304 0% 29.3% V5 (many diffs) n/a
Download CSV