Transcript: Mouse XR_878255.2

PREDICTED: Mus musculus Rho GTPase activating protein 6 (Arhgap6), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgap6 (11856)
Length:
3197
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_878255.2
NBCI Gene record:
Arhgap6 (11856)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_878255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105718 CCTTGTTAAAGGAGTTCCTTA pLKO.1 2533 3UTR 100% 4.950 6.930 N Arhgap6 n/a
2 TRCN0000378417 TGCTAATGACCGGGCATATAA pLKO_005 1994 3UTR 100% 15.000 10.500 N Arhgap6 n/a
3 TRCN0000362895 AGCTGAGTCTGAATCCTATTT pLKO_005 2332 3UTR 100% 13.200 9.240 N Arhgap6 n/a
4 TRCN0000105716 CGGGCATATAAACTGAAGCAA pLKO.1 2004 3UTR 100% 3.000 2.100 N Arhgap6 n/a
5 TRCN0000105717 GCCTTGTTAAAGGAGTTCCTT pLKO.1 2532 3UTR 100% 3.000 2.100 N Arhgap6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_878255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05848 pDONR223 100% 44.3% None (many diffs) n/a
2 ccsbBroad304_05848 pLX_304 0% 44.3% V5 (many diffs) n/a
3 TRCN0000476350 CACCAACCGCACCCAGCTGTATTC pLX_317 11.4% 44.3% V5 (many diffs) n/a
Download CSV