Transcript: Mouse XR_881434.2

PREDICTED: Mus musculus cyclin L2 (Ccnl2), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccnl2 (56036)
Length:
4560
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_881434.2
NBCI Gene record:
Ccnl2 (56036)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_881434.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262720 ACCTAAAGAACCAGATTATAA pLKO_005 1059 3UTR 100% 15.000 21.000 N Ccnl2 n/a
2 TRCN0000262718 ACACTAAGTCCTTCGTGAAAC pLKO_005 879 3UTR 100% 10.800 15.120 N Ccnl2 n/a
3 TRCN0000071793 CCCTCACAAGATAATCGTTAT pLKO.1 1132 3UTR 100% 10.800 15.120 N Ccnl2 n/a
4 TRCN0000262721 CGTGAGCGCTCAAGGTCATAT pLKO_005 3820 3UTR 100% 13.200 10.560 N Ccnl2 n/a
5 TRCN0000262717 TTTACCCAATCGTCCACATTG pLKO_005 3102 3UTR 100% 10.800 8.640 N Ccnl2 n/a
6 TRCN0000071796 GAGACGAATCAGGGATGTCAT pLKO.1 961 3UTR 100% 4.950 3.960 N Ccnl2 n/a
7 TRCN0000262719 GTGCATCTGTCCCGGTTAATG pLKO_005 4068 3UTR 100% 13.200 9.240 N Ccnl2 n/a
8 TRCN0000071795 CCCTGTAAATGGCTTGCTGAA pLKO.1 3441 3UTR 100% 4.050 2.835 N Ccnl2 n/a
9 TRCN0000071794 CCGGAAATCAAAGGACTGCAA pLKO.1 3672 3UTR 100% 2.640 1.848 N Ccnl2 n/a
10 TRCN0000071797 GCTTCTCCAAAGAGAAGGAAA pLKO.1 3529 3UTR 100% 0.495 0.248 Y Ccnl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_881434.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09080 pDONR223 100% 12.9% None (many diffs) n/a
2 ccsbBroad304_09080 pLX_304 0% 12.9% V5 (many diffs) n/a
3 TRCN0000467606 CAAACTCTCTAGTTGACCTGGGCT pLX_317 60.3% 12.9% V5 (many diffs) n/a
Download CSV