Transcript: Mouse XR_881691.2

PREDICTED: Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit 12C (Ppp1r12c), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp1r12c (232807)
Length:
3478
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_881691.2
NBCI Gene record:
Ppp1r12c (232807)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_881691.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084215 GAAGAAGAATTGCTGCTTCAT pLKO.1 1230 3UTR 100% 4.950 3.465 N Ppp1r12c n/a
2 TRCN0000084214 GCTGAAGAAGAATTGCTGCTT pLKO.1 1227 3UTR 100% 2.640 1.848 N Ppp1r12c n/a
3 TRCN0000084216 GATGAGAACCTGGAAGTCGTT pLKO.1 960 3UTR 100% 2.640 1.584 N Ppp1r12c n/a
4 TRCN0000084217 CCTGGCTGAGTCAGATGCCAT pLKO.1 1145 3UTR 100% 0.880 0.528 N Ppp1r12c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_881691.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.