Transcript: Human XR_921734.3

PREDICTED: Homo sapiens vacuolar protein sorting 45 homolog (VPS45), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VPS45 (11311)
Length:
2318
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_921734.3
NBCI Gene record:
VPS45 (11311)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_921734.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365272 GTTAAGCAAGTGATAACTAAA pLKO_005 657 3UTR 100% 13.200 18.480 N VPS45 n/a
2 TRCN0000154443 GCCTGGTATGAAAGTACTTCT pLKO.1 143 3UTR 100% 4.950 6.930 N VPS45 n/a
3 TRCN0000376630 CCACGAACTACTAGGCATAAA pLKO_005 794 3UTR 100% 13.200 9.240 N VPS45 n/a
4 TRCN0000370341 CCCAGAGTTGTCCTAACAATA pLKO_005 2027 3UTR 100% 13.200 9.240 N VPS45 n/a
5 TRCN0000365212 GTTGCTGCCAGGGTCGAAATT pLKO_005 514 3UTR 100% 13.200 9.240 N VPS45 n/a
6 TRCN0000370340 GGCATAGTGAGTATGGTATAC pLKO_005 183 3UTR 100% 10.800 7.560 N VPS45 n/a
7 TRCN0000156836 GATCAGCAAGAGTGACGTGAA pLKO.1 389 3UTR 100% 4.050 2.835 N VPS45 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_921734.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02669 pDONR223 100% 73.7% None 1_86del;1189_1256del;1865_2318del n/a
2 ccsbBroad304_02669 pLX_304 0% 73.7% V5 1_86del;1189_1256del;1865_2318del n/a
3 TRCN0000470892 GGTATCGAACGTACGTCATTGACT pLX_317 28.4% 73.7% V5 1_86del;1189_1256del;1865_2318del n/a
Download CSV