Transcript: Human XR_921902.2

PREDICTED: Homo sapiens cingulin (CGN), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CGN (57530)
Length:
2488
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_921902.2
NBCI Gene record:
CGN (57530)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_921902.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235551 GTGAGGAGGAAGGTTAGTTTG pLKO_005 1074 3UTR 100% 10.800 15.120 N CGN n/a
2 TRCN0000005715 GACTCACTCATCAACAAGTTT pLKO.1 612 3UTR 100% 5.625 3.938 N CGN n/a
3 TRCN0000005716 CCCGAGCTAGTGCTGGAGATA pLKO.1 1927 3UTR 100% 1.650 1.155 N CGN n/a
4 TRCN0000235549 TTGGACCAGGGTGAAGATTTA pLKO_005 1368 3UTR 100% 13.200 7.920 N CGN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_921902.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03828 pDONR223 100% 65.1% None 1_77del;2180_2184delCAAGG;2488_2489ins1203 n/a
2 ccsbBroad304_03828 pLX_304 0% 65.1% V5 1_77del;2180_2184delCAAGG;2488_2489ins1203 n/a
Download CSV