Transcript: Human XR_921977.3

PREDICTED: Homo sapiens acyl-CoA binding domain containing 6 (ACBD6), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACBD6 (84320)
Length:
7211
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_921977.3
NBCI Gene record:
ACBD6 (84320)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_921977.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154517 GCTGCAACATAGAGCTGACAT pLKO.1 944 3UTR 100% 4.950 6.930 N ACBD6 n/a
2 TRCN0000201261 GCCAAGCAATGCAGGAATATA pLKO.1 634 3UTR 100% 15.000 10.500 N Acbd6 n/a
3 TRCN0000297649 GCCAAGCAATGCAGGAATATA pLKO_005 634 3UTR 100% 15.000 10.500 N Acbd6 n/a
4 TRCN0000153178 GCCTGTGAGTTTCTGGATATT pLKO.1 1011 3UTR 100% 13.200 9.240 N ACBD6 n/a
5 TRCN0000151923 CCTAAACCAAGCTTCTTTGAT pLKO.1 558 3UTR 100% 5.625 3.938 N ACBD6 n/a
6 TRCN0000155878 CAGGACAATGAAGGCCAAACA pLKO.1 972 3UTR 100% 4.950 3.465 N ACBD6 n/a
7 TRCN0000156085 CCAGGTTGGAATCCTCAGATA pLKO.1 678 3UTR 100% 4.950 3.465 N ACBD6 n/a
8 TRCN0000152177 CCATATAACCAAAGCCATCAA pLKO.1 827 3UTR 100% 4.950 3.465 N ACBD6 n/a
9 TRCN0000152816 GAAGAAACCATCAGGGAAGAA pLKO.1 765 3UTR 100% 4.950 3.465 N ACBD6 n/a
10 TRCN0000151252 GATACCAGAGAAGAAAGGAAA pLKO.1 695 3UTR 100% 4.950 3.465 N ACBD6 n/a
11 TRCN0000153388 GATCGAGGACATAAGGAACTA pLKO.1 912 3UTR 100% 4.950 3.465 N ACBD6 n/a
12 TRCN0000152583 GCAGGAATATATCGCAGTAGT pLKO.1 644 3UTR 100% 4.950 3.465 N ACBD6 n/a
13 TRCN0000155005 GTCACAGTGTTGCTGCAACAT pLKO.1 933 3UTR 100% 4.950 3.465 N ACBD6 n/a
14 TRCN0000154483 GCTTGGAAAGCACTTGGTGAT pLKO.1 603 3UTR 100% 4.050 2.835 N ACBD6 n/a
15 TRCN0000217273 CCAAAGCCATCAAATCGAAAG pLKO.1 835 3UTR 100% 6.000 4.200 N Acbd6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_921977.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04376 pDONR223 100% 11.7% None 1_311del;1158_7211del n/a
2 ccsbBroad304_04376 pLX_304 0% 11.7% V5 1_311del;1158_7211del n/a
3 TRCN0000477142 TTTTTGTCGTAGCTTACGCACTCA pLX_317 45.4% 11.7% V5 1_311del;1158_7211del n/a
Download CSV