Transcript: Human XR_922904.2

PREDICTED: Homo sapiens serine/threonine kinase 36 (STK36), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STK36 (27148)
Length:
3085
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_922904.2
NBCI Gene record:
STK36 (27148)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_922904.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272696 GCTGGTCATGTCACCATAATA pLKO_005 1019 3UTR 100% 15.000 21.000 N STK36 n/a
2 TRCN0000380910 GTGACGTTGCTACTCTCTTTA pLKO_005 2610 3UTR 100% 13.200 18.480 N STK36 n/a
3 TRCN0000006987 CCGAGATATGAAGCCTCAGAA pLKO.1 625 3UTR 100% 4.950 6.930 N STK36 n/a
4 TRCN0000028805 GCATCCCAACATTGTGCATAT pLKO.1 433 3UTR 100% 10.800 8.640 N Stk36 n/a
5 TRCN0000006988 CGGGATCTTAGCCTCAGAATT pLKO.1 1321 3UTR 100% 0.000 0.000 N STK36 n/a
6 TRCN0000284808 CGGGATCTTAGCCTCAGAATT pLKO_005 1321 3UTR 100% 0.000 0.000 N STK36 n/a
7 TRCN0000272648 ATCTTGACTCAGGCCTATAAA pLKO_005 1157 3UTR 100% 15.000 10.500 N STK36 n/a
8 TRCN0000284806 TCTGTTGGCTGCATACTATAT pLKO_005 809 3UTR 100% 13.200 9.240 N STK36 n/a
9 TRCN0000006990 CCCAGAACTTCAGGTCCTAAA pLKO.1 1090 3UTR 100% 10.800 7.560 N STK36 n/a
10 TRCN0000381231 GGAATTTGCAACGAGAGATTG pLKO_005 393 3UTR 100% 10.800 7.560 N STK36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_922904.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15041 pDONR223 41.8% 62.7% None (many diffs) n/a
2 ccsbBroad304_15041 pLX_304 0% 62.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV