Transcript: Human XR_923046.2

PREDICTED: Homo sapiens ST6 beta-galactoside alpha-2,6-sialyltransferase 2 (ST6GAL2), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ST6GAL2 (84620)
Length:
1899
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_923046.2
NBCI Gene record:
ST6GAL2 (84620)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_923046.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035110 CGCATCATTAATTCGCAGATT pLKO.1 1403 3UTR 100% 4.950 6.930 N ST6GAL2 n/a
2 TRCN0000035111 GCATCGTCAGAGAAACCCAAA pLKO.1 1567 3UTR 100% 4.050 5.670 N ST6GAL2 n/a
3 TRCN0000035109 CGCAAATCTTAACCTGTGGTA pLKO.1 1507 3UTR 100% 2.640 3.696 N ST6GAL2 n/a
4 TRCN0000035112 CAGTCCCAAGATGGGTTTGAA pLKO.1 680 3UTR 100% 5.625 3.938 N ST6GAL2 n/a
5 TRCN0000035113 CGTGGTTATGAGAAAGATGTT pLKO.1 1364 3UTR 100% 4.950 3.465 N ST6GAL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_923046.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12833 pDONR223 100% 70.3% None (many diffs) n/a
2 ccsbBroad304_12833 pLX_304 0% 70.3% V5 (many diffs) n/a
3 TRCN0000475492 TTAGCCAACGAATTTCATCAAGCA pLX_317 26.8% 70.3% V5 (many diffs) n/a
Download CSV