Transcript: Human XR_924100.1

PREDICTED: Homo sapiens zinc finger DHHC-type containing 19 (ZDHHC19), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZDHHC19 (131540)
Length:
1068
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_924100.1
NBCI Gene record:
ZDHHC19 (131540)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_924100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137344 CAAGTGGGTCAATAACTGCAT pLKO.1 548 3UTR 100% 2.640 3.696 N ZDHHC19 n/a
2 TRCN0000134807 CCAGCAACTGGTATTTAACAA pLKO.1 1025 3UTR 100% 5.625 3.938 N ZDHHC19 n/a
3 TRCN0000137220 GCCAGCAACTGGTATTTAACA pLKO.1 1024 3UTR 100% 5.625 3.938 N ZDHHC19 n/a
4 TRCN0000134852 CTTACCTTCTTCAGTCTTGTT pLKO.1 333 3UTR 100% 4.950 3.465 N ZDHHC19 n/a
5 TRCN0000138832 GTTATCACAGGCTCCCTCTTT pLKO.1 309 3UTR 100% 4.950 3.465 N ZDHHC19 n/a
6 TRCN0000138599 CTGGCATCTTACATCAAGGCT pLKO.1 373 3UTR 100% 0.750 0.525 N ZDHHC19 n/a
7 TRCN0000138616 CCTTTCCTGTTATCACAGGCT pLKO.1 301 3UTR 100% 0.066 0.046 N ZDHHC19 n/a
8 TRCN0000138529 CCCTCTTTGTCCTTACCTTCT pLKO.1 322 3UTR 100% 4.050 2.430 N ZDHHC19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_924100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13160 pDONR223 100% 67.8% None 1_122del;812_983del;1068_1069ins72 n/a
2 ccsbBroad304_13160 pLX_304 0% 67.8% V5 1_122del;812_983del;1068_1069ins72 n/a
Download CSV