Transcript: Human XR_924637.3

PREDICTED: Homo sapiens uncharacterized LOC105374181 (LOC105374181), transcript variant X1, ncRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC105374181 (105374181)
Length:
8439
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_924637.3
NBCI Gene record:
LOC105374181 (105374181)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_924637.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 6075 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
2 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3871 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_924637.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10792 pDONR223 100% 2.5% None (many diffs) n/a
2 ccsbBroad304_10792 pLX_304 0% 2.5% V5 (many diffs) n/a
3 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 2.5% V5 (many diffs) n/a
Download CSV