Construct: ORF TRCN0000472287

Construct Description:

Construct Type:
ORF
Other Identifiers:
ORF004752.1_s317c1
Derived from:
ccsbBroadEn_10792
DNA Barcode:
GCCTGGAGAGCTTTCCTCGTCACG
Epitope Tag:
V5
Notes:
No stop codon in insert

Originally Annotated References:

Gene:
E2F2 (1870)

Vector Information:

Vector Backbone:
pLX_317
Pol II Cassette 1:
SV40-PuroR
Pol II Cassette 2:
EF1a-TRCN0000472287
Selection Marker:
PuroR
Visible Reporter:
n/a
Epitope Tag:
n/a

Current transcripts matched by this ORF:

Taxon Gene Symbol Description Transcript Nuc. Match %[?] Prot. Match %[?] Match Diffs[?]
1 human 112267959 LOC112267959 uncharacterized protein C9o... XM_024446606.1 69.5% 24% (many diffs)
2 human 159091 FAM122C family with sequence simila... NM_001170781.2 44.3% 3.7% (many diffs)
3 human 159091 FAM122C family with sequence simila... NM_001365746.1 44.3% 3.7% (many diffs)
4 human 159091 FAM122C family with sequence simila... NM_001365743.1 34.1% 9.8% (many diffs)
5 human 2272 FHIT fragile histidine triad dia... NR_148921.1 29.1% (many diffs)
6 human 124801 LSM12 LSM12 homolog NM_001369484.1 22.9% 10.1% (many diffs)
7 human 100132169 WASIR2 WASH and IL9R antisense RNA 2 NR_130735.1 20.9% (many diffs)
8 human 574406 ADAMTSL4-AS1 ADAMTSL4 antisense RNA 1 NR_104133.1 20.8% (many diffs)
9 human 340351 AGBL3 ATP/GTP binding protein like 3 NM_001367811.1 20.4% 10.1% (many diffs)
10 human 26091 HERC4 HECT and RLD domain contain... NM_001278187.2 20.1% 17.1% (many diffs)
11 human 26091 HERC4 HECT and RLD domain contain... XM_024447933.1 20.1% 17.1% (many diffs)
12 human 388325 SCIMP SLP adaptor and CSK interac... NM_001319190.1 18.1% 13.1% (many diffs)
13 human 106144599 LINC01259 long intergenic non-protein... NR_149076.1 18.1% (many diffs)
14 human 100128260 WASIR1 WASH and IL9R antisense RNA 1 NR_138048.1 17.6% (many diffs)
15 human 105379527 LOC105379527 uncharacterized LOC105379527 XR_951312.2 17.5% (many diffs)
16 human 7357 UGCG UDP-glucose ceramide glucos... XM_017015107.1 17.2% 14.1% (many diffs)
17 human 105371689 LOC105371689 uncharacterized LOC105371689 XR_922443.3 17.1% (many diffs)
18 human 158046 NXNL2 nucleoredoxin like 2 NM_145283.3 16.8% 11.8% (many diffs)
19 human 105373796 LOC105373796 uncharacterized LOC105373796 XR_001739151.1 15.2% (many diffs)
20 human 253980 KCTD13 potassium channel tetrameri... XM_017023106.2 15% 13.2% (many diffs)
21 human 105373796 LOC105373796 uncharacterized LOC105373796 XR_001739149.1 14.6% (many diffs)
22 human 105373796 LOC105373796 uncharacterized LOC105373796 XR_001739150.1 12.8% (many diffs)
23 human 729082 OIP5-AS1 OIP5 antisense RNA 1 NR_152821.1 12.6% (many diffs)
24 human 23029 RBM34 RNA binding motif protein 34 NR_144491.2 12.6% (many diffs)
25 human 23029 RBM34 RNA binding motif protein 34 NR_027762.3 12.6% (many diffs)
26 human 105369325 LOC105369325 uncharacterized LOC105369325 XR_950154.2 12.5% (many diffs)
27 human 54482 TRMT13 tRNA methyltransferase 13 h... XM_017001505.1 12.2% 3.6% (many diffs)
28 human 54482 TRMT13 tRNA methyltransferase 13 h... XM_017001504.1 11.7% 3.5% (many diffs)
29 human 105376412 LOC105376412 uncharacterized LOC105376412 XR_930661.2 11.6% (many diffs)
30 human 391712 TRIM61 tripartite motif containing 61 NM_001012414.3 11.6% 12.8% (many diffs)
31 human 102724659 C1orf167-AS1 C1orf167 antisense RNA 1 NR_126000.1 11.4% (many diffs)
32 human 101927257 MRTFA-AS1 MRTFA antisense RNA 1 NR_109965.1 11.2% (many diffs)
33 human 126123 IZUMO2 IZUMO family member 2 NM_001321449.1 11.1% 3.2% (many diffs)
34 human 102659353 THRIL TNF and HNRNPL related immu... NR_110375.1 11% (many diffs)
35 human 101929130 LOC101929130 uncharacterized LOC101929130 NR_135551.1 10.9% (many diffs)
36 human 101928847 LOC101928847 uncharacterized LOC101928847 NR_120563.1 10.9% (many diffs)
37 human 112268258 LOC112268258 uncharacterized LOC112268258 XR_002958495.1 10.8% (many diffs)
38 human 105376412 LOC105376412 uncharacterized LOC105376412 XR_002957063.1 10.7% (many diffs)
39 human 23029 RBM34 RNA binding motif protein 34 NR_144492.2 10.6% (many diffs)
40 human 11159 RABL2A RAB, member of RAS oncogene... NR_148880.2 10.4% (many diffs)
41 human 57862 ZNF410 zinc finger protein 410 NM_001242928.2 10.3% 9% (many diffs)
42 human 23029 RBM34 RNA binding motif protein 34 NR_144490.2 10.3% (many diffs)
43 human 1355 COX15 cytochrome c oxidase assemb... NM_001372024.1 10% 5.3% (many diffs)
44 human 11159 RABL2A RAB, member of RAS oncogene... NR_148879.2 10% (many diffs)
45 human 11159 RABL2A RAB, member of RAS oncogene... NR_148882.2 10% (many diffs)
46 human 107985403 LOC107985403 uncharacterized LOC107985403 XR_001754578.2 10% (many diffs)
47 human 11159 RABL2A RAB, member of RAS oncogene... NR_148881.2 10% (many diffs)
48 human 654434 SNHG20 small nucleolar RNA host ge... NR_027058.1 9.9% (many diffs)
49 human 128989 TANGO2 transport and golgi organiz... XR_002958662.1 9.8% (many diffs)
50 human 8678 BECN1 beclin 1 XM_011525421.2 9.6% 8% (many diffs)
51 human 8678 BECN1 beclin 1 XM_017025262.2 9.6% 8% (many diffs)
52 human 128989 TANGO2 transport and golgi organiz... XR_001755162.1 9.5% (many diffs)
53 human 128989 TANGO2 transport and golgi organiz... XR_001755161.1 9.5% (many diffs)
54 human 128989 TANGO2 transport and golgi organiz... XR_001755164.1 9.5% (many diffs)
55 human 102725068 MICB-DT MICB divergent transcript NR_149132.1 9.2% (many diffs)
56 human 101928555 LINC01537 long intergenic non-protein... NR_126364.1 9% (many diffs)
57 human 284023 RNF227 ring finger protein 227 NR_152444.1 8.9% (many diffs)
58 human 128989 TANGO2 transport and golgi organiz... XR_001755163.1 8.9% (many diffs)
59 human 100190986 LOC100190986 uncharacterized LOC100190986 NR_024456.1 8.8% (many diffs)
60 human 220074 LRTOMT leucine rich transmembrane ... NR_134858.1 8.7% (many diffs)
61 human 1992 SERPINB1 serpin family B member 1 NR_073112.2 8.7% (many diffs)
62 human 283089 WDR11-AS1 WDR11 antisense RNA 1 NR_033850.1 8.6% (many diffs)
63 human 100996251 LRIG2-DT LRIG2 divergent transcript NR_103777.1 8.6% (many diffs)
64 human 147276 C18orf15 chromosome 18 open reading ... NR_146617.1 8.4% (many diffs)
65 human 105374423 LOC105374423 uncharacterized LOC105374423 XR_925251.3 8.4% (many diffs)
66 human 7762 ZNF215 zinc finger protein 215 NM_001354854.1 8.3% 6.2% (many diffs)
67 human 140564 APOBEC3D apolipoprotein B mRNA editi... XR_001755170.2 8.3% (many diffs)
68 human 1992 SERPINB1 serpin family B member 1 NR_073111.2 8.2% (many diffs)
69 human 100131691 MZF1-AS1 MZF1 antisense RNA 1 NR_027334.2 8.2% (many diffs)
70 human 11159 RABL2A RAB, member of RAS oncogene... XR_002959036.1 8.1% (many diffs)
71 human 283888 IL21R-AS1 IL21R antisense RNA 1 NR_037158.1 8.1% (many diffs)
72 human 100652748 TIMM23B translocase of inner mitoch... NR_110767.1 8% (many diffs)
73 human 105369347 RELA-DT RELA divergent transcript XR_002957252.1 7.9% (many diffs)
74 human 101928401 LOC101928401 uncharacterized LOC101928401 NR_108099.1 7.9% (many diffs)
75 human 101929010 SIRPG-AS1 SIRPG antisense RNA 1 NR_110090.1 7.7% (many diffs)
76 human 105373975 LOC105373975 uncharacterized LOC105373975 XR_001739972.2 7.6% (many diffs)
77 human 105373975 LOC105373975 uncharacterized LOC105373975 XR_001739971.2 7.6% (many diffs)
78 human 140564 APOBEC3D apolipoprotein B mRNA editi... XR_001755169.2 7.6% (many diffs)
79 human 403150 FLJ31356 uncharacterized protein FLJ... NR_103831.1 7.6% (many diffs)
80 human 220074 LRTOMT leucine rich transmembrane ... NR_026886.3 7.5% (many diffs)
81 human 100652748 TIMM23B translocase of inner mitoch... NR_158651.1 7.5% (many diffs)
82 human 100652748 TIMM23B translocase of inner mitoch... NR_158652.1 7.4% (many diffs)
83 human 9609 RAB36 RAB36, member RAS oncogene ... XR_001755385.1 7.3% (many diffs)
84 human 100506215 PAXBP1-AS1 PAXBP1 antisense RNA 1 NR_038880.1 7.3% (many diffs)
85 human 643711 LOC643711 platelet activating factor ... NR_077240.1 7.2% (many diffs)
86 human 83878 USHBP1 USH1 protein network compon... XM_011528351.3 7.1% 6.3% (many diffs)
87 human 105372160 LOC105372160 uncharacterized LOC105372160 XR_001753474.2 7.1% (many diffs)
88 human 9050 PSTPIP2 proline-serine-threonine ph... XR_935264.2 7.1% (many diffs)
89 human 105372884 LOC105372884 uncharacterized LOC105372884 XR_001738428.2 7.1% (many diffs)
90 human 100874243 PRICKLE2-AS3 PRICKLE2 antisense RNA 3 NR_046702.1 7% (many diffs)
91 human 10695 CNPY3 canopy FGF signaling regula... NR_134881.1 7% (many diffs)
92 human 105372160 LOC105372160 uncharacterized LOC105372160 XR_001753473.2 7% (many diffs)
93 human 841 CASP8 caspase 8 NR_111983.2 6.9% (many diffs)
94 human 9601 PDIA4 protein disulfide isomerase... NR_163905.1 6.8% (many diffs)
95 human 80194 TMEM134 transmembrane protein 134 XR_950064.3 6.8% (many diffs)
96 human 728323 LINC01881 long intergenic non-protein... NR_130700.1 6.8% (many diffs)
97 human 128989 TANGO2 transport and golgi organiz... NR_104274.2 6.7% (many diffs)
98 human 105371554 LOC105371554 uncharacterized LOC105371554 XR_001753080.2 6.7% (many diffs)
99 human 283267 LINC00294 long intergenic non-protein... NR_015451.1 6.5% (many diffs)
100 human 128989 TANGO2 transport and golgi organiz... NR_136206.1 6.4% (many diffs)
101 human 378108 TRIM74 tripartite motif containing 74 XR_001744731.2 6.4% (many diffs)
102 human 728323 LINC01881 long intergenic non-protein... NR_130702.1 6.3% (many diffs)
103 human 100506637 PRKAR2A-AS1 PRKAR2A antisense RNA 1 NR_109997.1 6.3% (many diffs)
104 human 128989 TANGO2 transport and golgi organiz... NR_104275.2 6.3% (many diffs)
105 human 128989 TANGO2 transport and golgi organiz... NR_136212.1 6.2% (many diffs)
106 human 105376654 LOC105376654 uncharacterized LOC105376654 XR_931245.3 6.2% (many diffs)
107 human 105378248 LOC105378248 uncharacterized LOC105378248 XR_001749101.1 6.1% (many diffs)
108 human 100506637 PRKAR2A-AS1 PRKAR2A antisense RNA 1 NR_109996.1 6.1% (many diffs)
109 human 728323 LINC01881 long intergenic non-protein... NR_130701.1 6.1% (many diffs)
110 human 113157 RPLP0P2 ribosomal protein lateral s... NR_002775.2 6.1% (many diffs)
111 human 112268199 LOC112268199 uncharacterized LOC112268199 XR_002958141.1 6.1% (many diffs)
112 human 84620 ST6GAL2 ST6 beta-galactoside alpha-... XM_017005110.1 6.1% 3.9% (many diffs)
113 human 100506215 PAXBP1-AS1 PAXBP1 antisense RNA 1 NR_038879.1 6% (many diffs)
114 human 128989 TANGO2 transport and golgi organiz... NR_136211.1 6% (many diffs)
115 human 105378248 LOC105378248 uncharacterized LOC105378248 XR_001749102.1 6% (many diffs)
116 human 284578 MFSD4A-AS1 MFSD4A antisense RNA 1 NR_152721.1 6% (many diffs)
117 human 4750 NEK1 NIMA related kinase 1 NR_164631.1 5.9% (many diffs)
118 human 5140 PDE3B phosphodiesterase 3B NM_001363570.1 5.8% 4.3% (many diffs)
119 human 26608 TBL2 transducin beta like 2 XR_001744627.2 5.8% (many diffs)
120 human 728323 LINC01881 long intergenic non-protein... NR_130699.1 5.8% (many diffs)
121 human 105378248 LOC105378248 uncharacterized LOC105378248 XR_944894.2 5.8% (many diffs)
122 human 101928496 LINC01492 long intergenic non-protein... NR_121578.1 5.7% (many diffs)
123 human 388591 RNF207 ring finger protein 207 XR_001737162.2 5.6% (many diffs)
124 human 23639 LRRC6 leucine rich repeat contain... NR_135911.2 5.6% (many diffs)
125 human 107986496 LOC107986496 uncharacterized LOC107986496 XR_001743050.2 5.6% (many diffs)
126 human 105376654 LOC105376654 uncharacterized LOC105376654 XR_001748204.2 5.6% (many diffs)
127 human 57862 ZNF410 zinc finger protein 410 NM_001242924.2 5.6% 4.3% (many diffs)
128 human 105378248 LOC105378248 uncharacterized LOC105378248 XR_001749100.1 5.5% (many diffs)
129 human 378108 TRIM74 tripartite motif containing 74 XR_002956447.1 5.4% (many diffs)
130 human 130814 SLC66A3 solute carrier family 66 me... XR_001738632.2 5.4% (many diffs)
131 human 378108 TRIM74 tripartite motif containing 74 XR_002956450.1 5.4% (many diffs)
132 human 1503 CTPS1 CTP synthase 1 XR_001737004.1 5.3% (many diffs)
133 human 23639 LRRC6 leucine rich repeat contain... NR_135913.2 5.3% (many diffs)
134 human 105377308 LOC105377308 uncharacterized LOC105377308 XR_001741754.1 5.3% (many diffs)
135 human 378108 TRIM74 tripartite motif containing 74 XR_002956446.1 5.3% (many diffs)
136 human 378108 TRIM74 tripartite motif containing 74 XR_002956444.1 5.2% (many diffs)
137 human 378108 TRIM74 tripartite motif containing 74 XR_002956449.1 5.2% (many diffs)
138 human 90806 ANGEL2 angel homolog 2 XR_001737527.1 5.2% (many diffs)
139 human 388591 RNF207 ring finger protein 207 XR_946652.3 5.2% (many diffs)
140 human 388591 RNF207 ring finger protein 207 XR_946651.3 5.2% (many diffs)
141 human 105377308 LOC105377308 uncharacterized LOC105377308 XR_938936.2 5.1% (many diffs)
142 human 105372026 LOC105372026 uncharacterized LOC105372026 XR_001753371.1 5.1% (many diffs)
143 human 6773 STAT2 signal transducer and activ... XR_001748858.2 5.1% (many diffs)
144 human 388591 RNF207 ring finger protein 207 XR_001737159.2 5.1% (many diffs)
145 human 378108 TRIM74 tripartite motif containing 74 XR_001744749.2 5.1% (many diffs)
146 human 90806 ANGEL2 angel homolog 2 XR_247045.3 5.1% (many diffs)
147 human 105377308 LOC105377308 uncharacterized LOC105377308 XR_001741752.1 5.1% (many diffs)
148 human 6773 STAT2 signal transducer and activ... XR_001748856.1 5.1% (many diffs)
149 human 90806 ANGEL2 angel homolog 2 XR_001737528.1 5% (many diffs)
150 human 90806 ANGEL2 angel homolog 2 NR_125333.1 5% (many diffs)
151 human 6773 STAT2 signal transducer and activ... XR_001748857.1 5% (many diffs)
152 human 54737 MPHOSPH8 M-phase phosphoprotein 8 XR_002957453.1 4.9% (many diffs)
153 human 388591 RNF207 ring finger protein 207 XR_001737158.2 4.9% (many diffs)
154 human 23639 LRRC6 leucine rich repeat contain... NR_135912.2 4.9% (many diffs)
155 human 102723722 LOC102723722 uncharacterized LOC102723722 XR_001756660.1 4.9% (many diffs)
156 human 347862 GATD1 glutamine amidotransferase ... NR_134867.2 4.9% (many diffs)
157 human 54737 MPHOSPH8 M-phase phosphoprotein 8 XR_001749585.2 4.9% (many diffs)
158 human 347862 GATD1 glutamine amidotransferase ... NR_134868.2 4.8% (many diffs)
159 human 105369325 LOC105369325 uncharacterized LOC105369325 XR_950153.2 4.8% (many diffs)
160 human 347862 GATD1 glutamine amidotransferase ... XR_242802.3 4.8% (many diffs)
161 human 90806 ANGEL2 angel homolog 2 XR_001737530.1 4.7% (many diffs)
162 human 6773 STAT2 signal transducer and activ... XR_002957376.1 4.7% (many diffs)
163 human 54737 MPHOSPH8 M-phase phosphoprotein 8 XR_001749584.2 4.7% (many diffs)
164 human 90806 ANGEL2 angel homolog 2 XR_001737529.2 4.7% (many diffs)
165 human 6773 STAT2 signal transducer and activ... XR_002957375.1 4.6% (many diffs)
166 human 102723722 LOC102723722 uncharacterized LOC102723722 XR_001756658.1 4.6% (many diffs)
167 human 3903 LAIR1 leukocyte associated immuno... NR_110279.3 4.5% (many diffs)
168 human 148789 B3GALNT2 beta-1,3-N-acetylgalactosam... XR_001736990.1 4.5% (many diffs)
169 human 54737 MPHOSPH8 M-phase phosphoprotein 8 XR_001749586.2 4.5% (many diffs)
170 human 107987464 LOC107987464 uncharacterized LOC107987464 XR_001756825.2 4.5% (many diffs)
171 human 148789 B3GALNT2 beta-1,3-N-acetylgalactosam... XR_001736989.1 4.5% (many diffs)
172 human 90806 ANGEL2 angel homolog 2 XR_001737532.1 4.4% (many diffs)
173 human 90806 ANGEL2 angel homolog 2 XR_001737531.1 4.4% (many diffs)
174 human 388591 RNF207 ring finger protein 207 XR_001737164.2 4.4% (many diffs)
175 human 148789 B3GALNT2 beta-1,3-N-acetylgalactosam... XR_001736987.1 4.4% (many diffs)
176 human 9609 RAB36 RAB36, member RAS oncogene ... NR_146295.2 4.4% (many diffs)
177 human 9609 RAB36 RAB36, member RAS oncogene ... XR_001755384.1 4.3% (many diffs)
178 human 11184 MAP4K1 mitogen-activated protein k... NM_007181.6 4.3% 2.2% (many diffs)
179 human 22900 CARD8 caspase recruitment domain ... NR_033680.1 4.3% (many diffs)
180 human 107987464 LOC107987464 uncharacterized LOC107987464 XR_002958998.1 4.3% (many diffs)
181 human 105372026 LOC105372026 uncharacterized LOC105372026 XR_935292.2 4.3% (many diffs)
182 human 105372026 LOC105372026 uncharacterized LOC105372026 XR_935293.2 4.3% (many diffs)
183 human 23205 ACSBG1 acyl-CoA synthetase bubbleg... XM_011521391.2 4.3% 2.7% (many diffs)
184 human 3903 LAIR1 leukocyte associated immuno... NR_110280.3 4.2% (many diffs)
185 human 9609 RAB36 RAB36, member RAS oncogene ... XR_001755383.1 4.2% (many diffs)
186 human 9609 RAB36 RAB36, member RAS oncogene ... XR_001755386.1 4.2% (many diffs)
187 human 9609 RAB36 RAB36, member RAS oncogene ... XR_001755387.1 4.2% (many diffs)
188 human 9609 RAB36 RAB36, member RAS oncogene ... XR_001755381.2 4.2% (many diffs)
189 human 22900 CARD8 caspase recruitment domain ... NR_033678.1 4.2% (many diffs)
190 human 11184 MAP4K1 mitogen-activated protein k... XM_017026231.1 4.2% 3.6% (many diffs)
191 human 142679 DUSP19 dual specificity phosphatas... NR_135688.2 4.1% (many diffs)
192 human 22900 CARD8 caspase recruitment domain ... NR_033679.1 4.1% (many diffs)
193 human 9609 RAB36 RAB36, member RAS oncogene ... XR_001755380.2 4.1% (many diffs)
194 human 11184 MAP4K1 mitogen-activated protein k... XM_011526403.1 4.1% 3.5% (many diffs)
195 human 22900 CARD8 caspase recruitment domain ... XR_430193.3 4.1% (many diffs)
196 human 105377205 LOC105377205 uncharacterized LOC105377205 XR_002958750.1 4.1% (many diffs)
197 human 114819 CROCCP3 CROCC pseudogene 3 NR_023386.1 4% (many diffs)
198 human 102723722 LOC102723722 uncharacterized LOC102723722 XR_001756648.1 3.9% (many diffs)
199 human 132660 LIN54 lin-54 DREAM MuvB core comp... NR_110254.2 3.9% (many diffs)
200 human 285638 LOC285638 uncharacterized LOC285638 NR_149040.1 3.9% (many diffs)
201 human 23205 ACSBG1 acyl-CoA synthetase bubbleg... XM_017022025.2 3.9% 1.2% (many diffs)
202 human 105372637 LOC105372637 uncharacterized LOC105372637 XR_936795.3 3.8% (many diffs)
203 human 102723722 LOC102723722 uncharacterized LOC102723722 XR_001756646.1 3.8% (many diffs)
204 human 101927612 RNF139-AS1 RNF139 antisense RNA 1 (hea... NR_108047.1 3.7% (many diffs)
205 human 132660 LIN54 lin-54 DREAM MuvB core comp... NR_110253.2 3.7% (many diffs)
206 human 144100 PLEKHA7 pleckstrin homology domain ... XR_002957126.1 3.6% (many diffs)
207 human 107987097 LOC107987097 uncharacterized LOC107987097 XR_001746841.1 3.6% (many diffs)
208 human 4771 NF2 neurofibromin 2 NR_156186.2 3.5% (many diffs)
209 human 653121 ZBTB8A zinc finger and BTB domain ... NR_111980.2 3.5% (many diffs)
210 human 94056 SYAP1 synapse associated protein 1 NR_033181.2 3.5% (many diffs)
211 human 100533970 P2RX5-TAX1BP3 P2RX5-TAX1BP3 readthrough (... NR_037928.1 3.4% (many diffs)
212 human 9567 GTPBP1 GTP binding protein 1 XR_001755378.1 3.4% (many diffs)
213 human 63967 CLSPN claspin XR_001737361.2 3.4% (many diffs)
214 human 23241 PACS2 phosphofurin acidic cluster... XR_001750200.2 3.4% (many diffs)
215 human 9567 GTPBP1 GTP binding protein 1 XR_937969.2 3.4% (many diffs)
216 human 102723508 KANTR KDM5C adjacent transcript NR_145975.1 3.4% (many diffs)
217 human 255631 COL24A1 collagen type XXIV alpha 1 ... XM_017000930.1 3.4% 2.8% (many diffs)
218 human 51804 SIX4 SIX homeobox 4 XR_001750375.2 3.4% (many diffs)
219 human 102723508 KANTR KDM5C adjacent transcript NR_110456.2 3.3% (many diffs)
220 human 102723508 KANTR KDM5C adjacent transcript NR_145974.1 3.3% (many diffs)
221 human 112268432 LOC112268432 uncharacterized LOC112268432 XR_002959456.1 3.3% (many diffs)
222 human 102723508 KANTR KDM5C adjacent transcript NR_145973.1 3.3% (many diffs)
223 human 107987097 LOC107987097 uncharacterized LOC107987097 XR_001746840.1 3.3% (many diffs)
224 human 6867 TACC1 transforming acidic coiled-... NR_148048.2 3.1% (many diffs)
225 human 6867 TACC1 transforming acidic coiled-... NR_148047.2 3.1% (many diffs)
226 human 6867 TACC1 transforming acidic coiled-... NR_148053.2 3.1% (many diffs)
227 human 107987097 LOC107987097 uncharacterized LOC107987097 XR_001746839.1 3% (many diffs)
228 human 105372579 LOC105372579 uncharacterized LOC105372579 XR_001754564.2 3% (many diffs)
229 human 6715 SRD5A1 steroid 5 alpha-reductase 1 NR_136739.2 3% (many diffs)
230 human 54928 IMPAD1 inositol monophosphatase do... XR_928786.2 2.9% (many diffs)
231 human 105377205 LOC105377205 uncharacterized LOC105377205 XR_001755603.2 2.9% (many diffs)
232 human 105379251 LOC105379251 uncharacterized LOC105379251 XR_948994.3 2.8% (many diffs)
233 human 6867 TACC1 transforming acidic coiled-... NR_148052.2 2.8% (many diffs)
234 human 11196 SEC23IP SEC23 interacting protein XR_002956945.1 2.8% (many diffs)
235 human 51072 MEMO1 mediator of cell motility 1 NR_126034.3 2.8% (many diffs)
236 human 105376003 LOC105376003 uncharacterized LOC105376003 XR_929533.3 2.8% (many diffs)
237 human 105377205 LOC105377205 uncharacterized LOC105377205 XR_001755602.2 2.8% (many diffs)
238 human 51072 MEMO1 mediator of cell motility 1 NR_163996.1 2.7% (many diffs)
239 human 105379251 LOC105379251 uncharacterized LOC105379251 XR_001746684.2 2.7% (many diffs)
240 human 653857 ACTR3C actin related protein 3C NR_147022.1 2.7% (many diffs)
241 human 105374181 LOC105374181 uncharacterized LOC105374181 XR_924638.2 2.7% (many diffs)
242 human 51072 MEMO1 mediator of cell motility 1 NR_163998.1 2.7% (many diffs)
243 human 653857 ACTR3C actin related protein 3C NR_147021.1 2.7% (many diffs)
244 human 114004397 CA5BP1-CA5B CA5BP1-CA5B readthrough NR_160544.1 2.7% (many diffs)
245 human 653857 ACTR3C actin related protein 3C NR_147020.1 2.7% (many diffs)
246 human 51072 MEMO1 mediator of cell motility 1 NR_126032.2 2.6% (many diffs)
247 human 51072 MEMO1 mediator of cell motility 1 NR_163995.1 2.6% (many diffs)
248 human 653857 ACTR3C actin related protein 3C NR_147016.1 2.6% (many diffs)
249 human 51072 MEMO1 mediator of cell motility 1 NR_163997.1 2.6% (many diffs)
250 human 653857 ACTR3C actin related protein 3C NR_147014.1 2.6% (many diffs)
251 human 653857 ACTR3C actin related protein 3C NR_147018.1 2.5% (many diffs)
252 human 55346 TCP11L1 t-complex 11 like 1 XR_001747920.2 2.5% (many diffs)
253 human 653857 ACTR3C actin related protein 3C NR_147015.1 2.5% (many diffs)
254 human 105374181 LOC105374181 uncharacterized LOC105374181 XR_924637.3 2.5% (many diffs)
255 human 653857 ACTR3C actin related protein 3C NR_147017.1 2.5% (many diffs)
256 human 653857 ACTR3C actin related protein 3C NR_147019.1 2.5% (many diffs)
257 human 112268125 LOC112268125 uncharacterized LOC112268125 XR_002957586.1 2.5% (many diffs)
258 human 105379504 LOC105379504 uncharacterized LOC105379504 XR_001754936.1 2.5% (many diffs)
259 human 105372793 LOC105372793 uncharacterized LOC105372793 XR_001755014.1 2.5% (many diffs)
260 human 653857 ACTR3C actin related protein 3C NR_147012.2 2.5% (many diffs)
261 human 50937 CDON cell adhesion associated, o... XR_001747899.2 2.4% (many diffs)
262 human 253714 MMS22L MMS22 like, DNA repair protein XR_942376.1 2.4% (many diffs)
263 human 55729 ATF7IP activating transcription fa... XR_001748808.2 2.4% (many diffs)
264 human 55131 RBM28 RNA binding motif protein 28 XR_001744830.1 2.3% (many diffs)
265 human 199857 ALG14 ALG14 UDP-N-acetylglucosami... NR_131032.2 2.3% (many diffs)
266 human 54625 PARP14 poly(ADP-ribose) polymerase... XR_002959544.1 2.2% (many diffs)
267 human 57465 TBC1D24 TBC1 domain family member 24 XR_001751956.1 2.1% (many diffs)
268 human 80255 SLC35F5 solute carrier family 35 me... NR_104470.3 2% (many diffs)
269 human 105369561 LOC105369561 uncharacterized LOC105369561 XR_001748438.1 1.9% (many diffs)
270 human 9819 TSC22D2 TSC22 domain family member 2 NR_130136.2 1.8% (many diffs)
271 human 107986485 LOC107986485 uncharacterized LOC107986485 XR_001743012.1 1.7% (many diffs)
272 human 285220 EPHA6 EPH receptor A6 XR_001740110.1 1.6% (many diffs)
273 human 6391 SDHC succinate dehydrogenase com... NR_103459.2 1.6% (many diffs)
274 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_002957877.1 1.3% (many diffs)
275 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752165.2 1.2% (many diffs)
276 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752161.2 1.2% (many diffs)
277 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752163.2 1.2% (many diffs)
278 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_933530.3 1.2% (many diffs)
279 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752157.2 1.2% (many diffs)
280 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752154.2 1.2% (many diffs)
281 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752158.2 1.2% (many diffs)
282 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752150.2 1.2% (many diffs)
283 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752152.2 1.2% (many diffs)
284 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752147.2 1.1% (many diffs)
285 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_002957878.1 1.1% (many diffs)
286 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752166.2 1.1% (many diffs)
287 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_002957875.1 1.1% (many diffs)
288 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752149.2 1% (many diffs)
289 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752143.2 1% (many diffs)
290 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_002957876.1 1% (many diffs)
291 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752164.2 1% (many diffs)
292 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752146.2 1% (many diffs)
293 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752155.2 1% (many diffs)
294 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752162.2 1% (many diffs)
295 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_002957874.1 1% (many diffs)
296 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752153.2 1% (many diffs)
297 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752144.2 1% (many diffs)
298 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752156.2 1% (many diffs)
299 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752151.2 1% (many diffs)
300 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752160.2 1% (many diffs)
301 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752159.2 1% (many diffs)
302 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752140.2 .9% (many diffs)
303 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752148.2 .9% (many diffs)
304 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752145.2 .9% (many diffs)
305 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752141.2 .9% (many diffs)
306 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752142.2 .9% (many diffs)
307 human 102724859 LOC102724859 uncharacterized LOC102724859 XR_001752139.2 .9% (many diffs)
Download CSV

Sequence Information

Note: uppercase bases indicate empirically verified sequence.

ORF start:
262
ORF end:
511
ORF length:
249
Sequence:
1AGTTCTCGAG CTTTTGGAGT ACGTCGTCTT TAGGTTGGGG GGAGGGGTTT TATGCGATGG
61AGTTTCCCCA CACTGAGTGG GTGGAGACTG AAGTTAGGCC AGCTTGGCAC TTGATGTAAT
121TCTCCTTGGA ATTTGCCCTT TTTGAGTTTG GATCTTGGTT CATTCTCAAG CCTCAGACAG
181TGGTTCAAAG TTTTTTTCTT CCATTTCAGG TGTCGTGAGG CTAGCATCGA TTGATCAACA
241AGTTTGTACA AAAAAGTTGG CATGGAGTCT CGCTCTGTTG CCCAGGCTGG AGTGCAGTGG
301CCTGATCTCG GCTCACTGCA ACCTCTGCCT CCCAGGTTCA AGCGATTCTT CTGCCTCAGC
361CTCCAGAGTA GCTGGGACTA TAGACATGCA CCACCACGCC CGGCTAATTT TGTATTTTTG
421GTCGAGACGG GGTTTTGCCA TGTTAGTCAG GCTGGTCTTG AACTCCTGAC CTCAAGTGAT
481CCACCACCTC GGCCTCCCAA AGTGTTGAGA TGCCCAACTT TCTTGTACAA AGTGGTTGAT
541ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT
601CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGCCT
661GGAGAGCTTT CCTCGTCACG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt
721gtgaaagatt

Download FASTA (ORF) (Full)

GPP Web Portal Terms of Service

Effective Date: December 8, 2025
By using this site, you agree to our terms and conditions below.

Overview of Terms

The data made available on this website were generated for research purposes and are not intended for clinical or commercial uses. Commercial use (or other use for profit-making purposes) of the GPP Web Portal and its tools, is not permitted under these terms and may require a separate license agreement from Broad or its contributors. For more information, please contact partnering@broadinstitute.org.

The original data may be subject to rights claimed by third parties, including but not limited to, patent, copyright, other intellectual property rights, biodiversity-related access and benefit-sharing rights. It is the responsibility of users of Broad Institute services to ensure that their use of the data does not infringe any of the rights of such third parties.

Any questions or comments concerning these Terms of Use can be addressed to: legal@broadinstitute.org.

By accessing and viewing this GPP Web Portal, you agree to the following terms and conditions:

Attribution

You agree to acknowledge the Broad Institute (e.g., in publications, services or products) for any of your use of its online services, databases or software in accordance with good scientific practice. You agree to use the acknowledgment wording provided for the relevant tools as indicated on the FAQ for each tool.

Updating the Terms of Use

We reserve the right to update these Terms of Use at any time. When alterations are inevitable, we will attempt to give reasonable notice of any changes by placing a notice on our website, but you may wish to check each time you use the website. The date of the most recent revision will appear on this, the "GPP Web Portal Terms of Use" page. If you do not agree to these changes, please do not continue to use our online services. We will also make available an archived copy of the previous Terms of Use for comparison.

Indemnification and Disclaimer of Warranties

You are using this GPP Web Portal at your own risk, and you hereby agree to hold Broad and its contributors and their trustees, directors, officers, employees, and affiliated investigators harmless for any third party claims which may arise from your use of the GPP Web Portal, the tools available therein, or any portion thereof. Further, you agree to indemnify Broad, its contributors, and its and their trustees, directors, officers, employees, affiliated investigators, students, and affiliates for any loss, costs, claims, damages, or other liabilities arising from any unpermitted commercial or profit-making use you make of the GPP Web Portal. The GPP Web Portal is a research tool and is provided "as is". Broad does not represent that the GPP Web Portal is free of errors or bugs or suitable for any particular tasks.

ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, NONINFRINGEMENT, OR THE ABSENCE OF LATENT OR OTHER DEFECTS ARE DISCLAIMED. IN NO EVENT SHALL BROAD OR ITS CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THE GPP WEB PORTAL, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.

Governing Law

The terms and conditions herein shall be construed, governed, interpreted, and applied in accordance with the internal laws of the Commonwealth of Massachusetts, U.S.A. Furthermore, by accessing, downloading, or using the Database, You consent to the personal jurisdiction of, and venue in, the state and federal courts within Massachusetts with respect to Your download or use of the Database.