Transcript: Human XR_927481.3

PREDICTED: Homo sapiens pseudouridine synthase 7 (PUS7), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PUS7 (54517)
Length:
3433
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_927481.3
NBCI Gene record:
PUS7 (54517)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_927481.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293799 ACTGCCACTTCGTACTATATA pLKO_005 1011 3UTR 100% 15.000 21.000 N PUS7 n/a
2 TRCN0000061934 GCCTACCGAAAGATCATTATT pLKO.1 1885 3UTR 100% 15.000 21.000 N PUS7 n/a
3 TRCN0000286367 GCCTACCGAAAGATCATTATT pLKO_005 1885 3UTR 100% 15.000 21.000 N PUS7 n/a
4 TRCN0000061933 CGTTGCATTGATAGGCCCATT pLKO.1 2762 3UTR 100% 4.050 5.670 N PUS7 n/a
5 TRCN0000293798 GGCACTGGTTGTCGAAGATAA pLKO_005 265 3UTR 100% 13.200 10.560 N PUS7 n/a
6 TRCN0000293801 TCTTAGTTCAGACTCATATAT pLKO_005 2223 3UTR 100% 15.000 10.500 N PUS7 n/a
7 TRCN0000293800 CTTGCCTGGTTTCGATGTTAT pLKO_005 1758 3UTR 100% 13.200 9.240 N PUS7 n/a
8 TRCN0000061937 CCACTGAAATTGGGAGAGCTT pLKO.1 1241 3UTR 100% 2.640 1.848 N PUS7 n/a
9 TRCN0000136053 GAAGAAGAGGAGGAAGATGAA pLKO.1 467 3UTR 100% 4.950 2.475 Y GRWD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_927481.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12049 pDONR223 100% 20% None 1_1447del;1566_1567ins73;2152_3433del n/a
2 ccsbBroad304_12049 pLX_304 0% 20% V5 1_1447del;1566_1567ins73;2152_3433del n/a
3 TRCN0000467597 AACACGGAGAAACTCTCCCACCTT pLX_317 62.4% 20% V5 1_1447del;1566_1567ins73;2152_3433del n/a
Download CSV