Transcript: Human XR_928762.2

PREDICTED: Homo sapiens somatomedin B and thrombospondin type 1 domain containing (SBSPON), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SBSPON (157869)
Length:
771
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_928762.2
NBCI Gene record:
SBSPON (157869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_928762.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113859 CCTTTATAACTACCTCTGCAT pLKO.1 688 3UTR 100% 2.640 1.848 N SBSPON n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_928762.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13303 pDONR223 100% 45.4% None 1_126del;521_681del;771_772ins293 n/a
2 ccsbBroad304_13303 pLX_304 0% 45.4% V5 1_126del;521_681del;771_772ins293 n/a
3 TRCN0000476921 CTCTTCCACAATTAAGATATCTAA pLX_317 42.5% 45.4% V5 1_126del;521_681del;771_772ins293 n/a
Download CSV