Transcript: Human XR_929731.3

PREDICTED: Homo sapiens torsin family 1 member A (TOR1A), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TOR1A (1861)
Length:
2224
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_929731.3
NBCI Gene record:
TOR1A (1861)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_929731.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082885 CCGGAACCTCATTGATTATTT pLKO.1 972 3UTR 100% 15.000 21.000 N TOR1A n/a
2 TRCN0000333186 CCGGAACCTCATTGATTATTT pLKO_005 972 3UTR 100% 15.000 21.000 N TOR1A n/a
3 TRCN0000082884 GCGAGGTCCATCTTCATATTT pLKO.1 515 3UTR 100% 15.000 21.000 N TOR1A n/a
4 TRCN0000344797 TCAAGCCTTTCCTCGACTATT pLKO_005 576 3UTR 100% 13.200 18.480 N TOR1A n/a
5 TRCN0000344737 GTTCACCAAGTTAGATTATTA pLKO_005 1161 3UTR 100% 15.000 10.500 N TOR1A n/a
6 TRCN0000082887 GCCACATTGCACTTTCCACAT pLKO.1 428 3UTR 100% 4.050 2.835 N TOR1A n/a
7 TRCN0000082883 GCCATATTAAATCTTCCTCAT pLKO.1 2061 3UTR 100% 4.050 2.835 N TOR1A n/a
8 TRCN0000082886 AGCAAGATCATCGCAGAGAAT pLKO.1 362 3UTR 100% 4.950 2.970 N TOR1A n/a
9 TRCN0000333185 AGCAAGATCATCGCAGAGAAT pLKO_005 362 3UTR 100% 4.950 2.970 N TOR1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_929731.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06133 pDONR223 100% 44.7% None (many diffs) n/a
2 ccsbBroad304_06133 pLX_304 0% 44.7% V5 (many diffs) n/a
3 TRCN0000469618 ACCTCCCCCTTAATATCGTTATAG pLX_317 38.4% 44.7% V5 (many diffs) n/a
4 ccsbBroadEn_10791 pDONR223 100% 24.4% None (many diffs) n/a
5 ccsbBroad304_10791 pLX_304 0% 24.4% V5 (many diffs) n/a
6 TRCN0000467448 GGTGCACCACTCAACTTCTGTCAG pLX_317 71.3% 24.4% V5 (many diffs) n/a
Download CSV