Transcript: Human XR_930841.1

PREDICTED: Homo sapiens USH1 protein network component harmonin (USH1C), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USH1C (10083)
Length:
1854
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_930841.1
NBCI Gene record:
USH1C (10083)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_930841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429910 ACCAGATTGTCGAAGTCAATG pLKO_005 876 3UTR 100% 10.800 7.560 N USH1C n/a
2 TRCN0000084145 CCGGATCAATGGATATTCCAT pLKO.1 514 3UTR 100% 3.000 2.100 N USH1C n/a
3 TRCN0000084147 CCGGAAATATGAGGAAGGCTT pLKO.1 1661 3UTR 100% 2.640 1.848 N USH1C n/a
4 TRCN0000084146 GCAGAGAAGGACTATCTCTAT pLKO.1 170 3UTR 100% 0.495 0.347 N USH1C n/a
5 TRCN0000080259 GCTGGTCATCAATGAACCCAA pLKO.1 250 3UTR 100% 2.640 3.696 N Ush1c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_930841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14038 pDONR223 100% 70.2% None (many diffs) n/a
2 ccsbBroad304_14038 pLX_304 0% 70.2% V5 (many diffs) n/a
3 TRCN0000465750 CAATCGATTGGTATATCGAAATTC pLX_317 23.4% 70.2% V5 (many diffs) n/a
Download CSV